Labshake search
Citations for Santa Cruz :
401 - 443 of 443 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... and blocked for 30 minutes in 10% donkey serum followed by incubation with mouse anti-human SOX18 (1:50; Santa Cruz Biotechnology), rabbit anti-human SREBP2 and UEA1 fluorescently labeled with Alexa Fluor 649 (1:50 ...
-
bioRxiv - Immunology 2023Quote: ... The assay for CLCA1 was performed using rabbit anti-human CLCA1 (amino acid 33-63) and HRP-conjugated goat anti-rabbit IgG antibody (Santa Cruz Biotechnology) as described previously (12) ...
-
bioRxiv - Immunology 2019Quote: ... and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS: sc-400769-HDR-2, RIG-I: sc-400812-HDR, both Santa Cruz). The knockout plasmids are a mixture of three plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... U2OS and HEK293 ATM KO cells were generated using the ATM CRISPR/Cas9 KO and ATM HDR plasmids (sc-400192, sc-400192-HDR from Santa Cruz) according to the manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2021Quote: ... two pairs of mouse CCN4 double nickase plasmids that target the mouse CCN4 gene at different locations were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2020Quote: Human T cells (2-5 x 106) were transfected with 3 μg of TERT KO CRISPR/Cas9 plasmid (h) (sc-400316, Santa Cruz) according to the manufacturer instructions ...
-
bioRxiv - Neuroscience 2022Quote: The SPPL2b gene was knocked out in HEK293 WT cells by using the SPPL2b CRISPR/Cas9 Knockout Plasmid kit from Santa Cruz Biotechnology® (sc-405646) ...
-
bioRxiv - Cell Biology 2022Quote: ... Mac-1-HEK293 cells in which CD47 gene expression was disrupted were generated using CD47 CRISPR/Cas9 KO Plasmid (h) obtained from Santa Cruz Biotechnology (catalog #sc-400508) ...
-
bioRxiv - Cancer Biology 2023Quote: HCT116 p53 null or knockout cells were used as parent cell line to generate a short telomere version using commercial hTERC knockdown plasmid and a scrambled control from Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2024Quote: ... all AGPS KO single cell clones were generated via transient transfection with mouse AGPS CRISPR/Cas9 KO Plasmids (Catalog no. sc-432759, Santa Cruz) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Pik3ca-/- (αKO) KPC cell lines were generated by transfecting WT KPC cells with Pik3ca CRISPR/Cas9 αKO and HDR plasmids (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with one of the following anti-human primary antibodies diluted in blocking buffer: goat PAX3 (1:100; 4°C overnight; Santa Cruz, sc-34916), mouse TYRP1 (MEL-5 ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 20 h at 4 °C in the blocking buffer with goat IgG antibodies specific for the human AIF protein (Santa Cruz Biotechnology, USA) diluted 1:200 ...
-
bioRxiv - Genomics 2022Quote: ... The media on human RPTEC was then changed to the fresh lentiviral supernatants supplemented with polybrene (0.5 µg/ml, Santa Cruz Biotechnology; sc-134220) and cultured for 24 h ...
-
bioRxiv - Genomics 2021Quote: ... The media on human RPTEC was then changed to the fresh lentiviral supernatants supplemented with polybrene (0.5 μg/ml, Santa Cruz Biotechnology; sc-134220) and cultured for 24 h ...
-
bioRxiv - Genetics 2022Quote: ... anti-rabbit αß-crystallin (Enzo, ADI-SPA-223), anti-rabbit DNAJB4 (proteintech, 13064-1-AP) and anti-human DNAJB4 (Santa Cruz, sc-100711). Rhodamine Phalloidin Reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... human primary SCLC tumor specimens and genetic engineered mouse model (GEMM) tumor specimens with anti-NKX2-1 (1:100; Santa Cruz, sc-53136), anti-SOX1 (R&D ...
-
Efficient Methods for Target Gene Manipulation in Haematopoietic Stem Cell Derived Human NeutrophilsbioRxiv - Cell Biology 2023Quote: ... Slides were washed in dPBS three times and stained with primary antibodies: goat anti-human neutrophil elastase (Santa Cruz Biotech 9520, 1:1000), and goat anti-human myeloperoxidase (Abcam 9535 ...
-
bioRxiv - Physiology 2023Quote: ... Histological sections were incubated overnight at 4°C with the primary antibodies (rabbit anti-human COX1, ab133319, abcam, 1:200; rat anti-mouse Endomucin, sc-5495 Santa Cruz, 1:200), then incubated with Texas Red-conjugated goat anti-Rat (TI-9400 Vector Labs ...
-
bioRxiv - Cancer Biology 2021Quote: UM-UC-1 cells (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz; sc-400743) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected with S1R-GFP plasmids and stained with primary (anti-GFP, ab13970, 1:500, Abcam and anti-TOM20, FL-145, 1:500, Santa Cruz Biotechnology) and secondary antibodies (488 goat anti-chicken ...
-
bioRxiv - Cancer Biology 2022Quote: ... The stable ROR2 knockout JNK reporter AGS cell line was generated by transfection first with the validated ROR2 CRISPR plasmids sc-401324 (Santa Cruz Biotechnology). ROR2 knockout clones were confirmed by sequencing ...
-
bioRxiv - Developmental Biology 2022Quote: β-catenin knockout cells were generated via transient transfection with a CRISPR/Cas9 Ctnnb1 KO plasmid according to the manufacturer’s instructions (Santa Cruz, sc-419477). For knock-out validation ...
-
bioRxiv - Immunology 2021Quote: ... siRNA plasmid against hDlg1 (sc-36452) and hSHP1 (sc-36490)and agarose-conjugated CD3-ζ mouse monoclonal IgG1 (1239-AC) from Santa Cruz, California,USA ...
-
bioRxiv - Genomics 2022Quote: Parental U2OS and RPE-1 cells were seeded in 6-well plates and the next day transfected with RFX7 CRISPR/Cas9 KO Plasmid (#sc-408041, Santa Cruz Biotechnology) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... ChIP for human endogenous GATA4 in SH-SY5Y cells was carried out using the GATA-4 (G-4) (Cat. sc-25310, Santa Cruz, 1:50, RRID:AB_627667). All primers for qRT-PCR or ChIP-qPCR are as indicated in Table S3.
-
bioRxiv - Molecular Biology 2020Quote: Ishikawa cells were grown in a 6-well plate in full media and co-transfected with the PEA3 (alias for ETV4) CRISPR/Cas9 KO plasmid (Santa Cruz, sc-422185) and the PEA3 HDR plasmid (Santa Cruz ...
-
bioRxiv - Biochemistry 2020Quote: ... 10 μg of total membrane protein in membrane vesicles of MQ614 harboring the indicated MhsT variant (or the control plasmid) were subjected to 11 % SDS-PAGE followed by incubation of the membrane with the His probe antibody (Santa Cruz Biotechnology, Inc.) and horseradish peroxidase-based chemiluminescence detection (SuperSignal® West Pico kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... Luc-KPV+/+ cells were transfected with a commercially available CRISPR/Cas9 vimentin knockout plasmid according to manufacturer’s directions (Santa Cruz Biotechnology sc-423676).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... containing IgG to the SARS-CoV-2 nucleoprotein (NP) and with mouse anti-human GAPDH monoclonal antibody (G-9: Santa Cruz Biotechnology, Dallas, TX, USA). The antigen-antibody complexes were detected using peroxidase-conjugated goat anti-human or goat anti-mouse IgG (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... Positive convalescent serum (heat-inactivated at 56°C for 30 min) of a COVID-19 patient and anti-human IgG (Santa Cruz Biotechnology, Dallas, TX, USA) were used for a viral inhibition as positive control and negative control ...
-
bioRxiv - Cancer Biology 2023Quote: ... the membranes were incubated with the primary antibodies overnight at 4°C in TBST and 3% BSA. The primary antibodies used in this study are anti-(α) human CHI3L1 (R&D. AF2599-SP) and α-KEAP-1(Santa Cruz Biotechnology. 8047), β-actin (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2020Quote: ... BT549 and 4T1 cell lines with PI4KIIIβ deletion by CRISPR/Cas9 were generated by transfecting wildtype cells with CRISPR/Cas9 plasmid (Santa Cruz Biotechnology, Mississauga, Canada) followed by single cell FACS of green fluorescent cells into 96-well plates ...
-
bioRxiv - Cancer Biology 2019Quote: ... αKO KPC cells lacking CD80 (referred to as αKO/CD80KO) were generated by transfecting αKO cells with B7-1 CRISPR/Cas9 KO plasmid (Santa Cruz Biotechnology, sc-419570). 48 hours after transfection ...
-
bioRxiv - Cancer Biology 2020Quote: Sections from formalin fixed paraffin embedded mouse tissue or a human pancreatic cancer tissue microarray (Biomax PA961e) were stained with antibodies against PC (Santa Cruz sc-67021, 1:50 dilution) or ME1 (Proteintech 16619-1-AP ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 3 x105 cells were incubated on ice with mouse anti-human ACE2 monoclonal antibody conjugated to AF-647 (Santa Cruz Biotechnology, USA, cat. SC-390851) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were probed with primary anti-human nuclear factorkappa B (NF-κB) p65 (c-20) sc-372 (1:200 dilution, Santa Cruz Biotechnology, Palo Alto, CA, USA) overnight at 4°C ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: HEK293 YAP-/- were generated using commercially available plasmids with specific CRISPR-Cas-9 single guide RNA (sgRNA) and sequence for homology-directed repair targeting YAP sequence (Santa Cruz Biotechnology, Dallas, TX, USA) as previously reported 36 ...
-
bioRxiv - Neuroscience 2022Quote: ... On the day of the transfection two separate solutions were prepared: Solution A was made by adding 2 μg of plasmid DNA (Santa Cruz Biotechnology ®, sc-405646) into 130 μl of plasmid transfection medium (Santa Cruz Biotechnology ® ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR/Cas9 genome editing was used to target SNCA in SK-MEL-29 cells as described previously 30 for SK-MEL-28 cells using α-syn CRISPR/Cas9 knockout plasmid (Santa Cruz Biotechnology # sc-417273-NIC). Lentivirus particles expressing human α-syn under cytomegalovirus (CMV ...
-
bioRxiv - Cancer Biology 2023Quote: ... CRISPR/Cas9 genome editing was used to target SNCA in WM983B cells as described previously for SK-MEL-28 cells27 using α-syn CRISPR/Cas9 knockout plasmid (Santa Cruz Biotechnology # sc-417273-NIC). Lentivirus particles expressing human α-syn under cytomegalovirus (CMV ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% CO2.GIV knock-out (KO) cell lines were generated using Pooled guide RNA plasmids (commercially obtained from Santa Cruz Biotechnology; Cat# sc-402236-KO-2), as described earlier(67) ...