Labshake search
Citations for Santa Cruz :
201 - 250 of 443 citations for Human MMP24 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Mouse anti-human anti-myeloperoxidase (MPO, clone 266-6K1, Santa Cruz Biotechnology) was added in a 1:100 concentration and incubated 1h at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse anti-human RAD51C antibody (sc-56214) was purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2022Quote: ... The PE-conjugated mouse anti-human NR4A3 mAb was from Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... or anti-human pab240 (1:500) (Santa Cruz Biotechnology, Dallas, TX, USA) and rabbit polyclonal oligomer-specific (A11)(Kayed et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-human Tropomyosin (1:100, F-6, sc-74480, Santa Cruz Biotechology ...
-
bioRxiv - Neuroscience 2024Quote: ... monoclonal anti-Lamp1 (clone H5G11, used for human samples, Santa Cruz Biotechnology), chicken anti-GFP (#ab13970 ...
-
bioRxiv - Immunology 2021Quote: Three different RIPK1 CRISPR/Cas9 knockout plasmids (Santa Cruz sc-400377) respectively encoding guide RNA targeting sequences GGCTTTGCGTTGACGTCATTC (gRNAa) ...
-
bioRxiv - Developmental Biology 2020Quote: ... or human leukocyte antigen-G (HLAG; sc-21799, 1:50, Santa Cruz Biotechnology). The following day ...
-
bioRxiv - Neuroscience 2021Quote: Human samples were homogenized in RIPA lysis buffer with proteinase inhibitors (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... raised against the 114 N-terminal portion of human DDX3x (Santa Cruz Biotehcnology); polyclonal anti DDX3 ...
-
bioRxiv - Immunology 2019Quote: ... rabbit anti-human IL-18 (0.2 μg/ml; sc-7954; Santa Cruz Biotechnology), mouse anti-human caspase-1 (0.1 μg/ml ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... On the four islands with human populations (Floreana, Isabela, San Cristobal, Santa Cruz), site urbanization categories were classified as ...
-
bioRxiv - Microbiology 2020Quote: ... and horseradish peroxidase–conjugated antibody specific for human IgG (Santa Cruz Biotechnology, Dallas) as described previously [77].
-
bioRxiv - Neuroscience 2020Quote: ... was performed by transfecting HUVECs with siRNA against human Nucleolin (50nM, Santa Cruz), or a control siRNA (Santa cruz) ...
-
bioRxiv - Immunology 2020Quote: ... and anti-human Integrin α-X (Santa Cruz cat. 1185, 1:50 dilution) overnight at 4℃ ...
-
bioRxiv - Developmental Biology 2022Quote: ... This study used a human PRMT1-specific siRNA (cat#sc-41069, Santa Cruz) and a non-targeting control siRNA (Dharmacon ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA duplexes used were as follows: human SENP3 siRNA (sc-44451, Santa Cruz), non-specific siRNA or a pool of human Fis1 siRNA (synthesized by Eurofins MWG Operon) ...
-
bioRxiv - Physiology 2022Quote: ... Antibodies against human IRS4 (sc-100854) and TRPM6 were purchased from Santa Cruz Biotechnology (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... as well as the PE-conjugated mouse anti-human NR4A3 (Santa Cruz Biotechnology). Intra-cellular labelling for detection of IL-10 was performed using the Intracellular Fixation & Permeabilization Buffer Set (eBioscience ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human cSRC (rabbit polyclonal, SRC2, Santa Cruz, sc-18; WB 1:1000), anti-human ILK (rabbit monoclonal ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse anti-human SDC-1 IgG1 (B-A38; Santa Cruz Biotechnology, Texas, USA), mouse anti-human SDC-4 IgG2a (5G9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Rabbit anti-human GAPDH and mice anti-YAP are obtained from Santa Cruz Biotechnology.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then incubated with mouse anti-human occludin (Santa Cruz, E-5) and rat anti-human E-cadherin (EMD Millipore ...
-
bioRxiv - Cell Biology 2024Quote: ... Human RARα siRNA (cat. #sc-29465, Santa Cruz Biotechnology, Santa Cruz, CA, USA); RARα antibody (cat ...
-
bioRxiv - Molecular Biology 2024Quote: ... blocked and then incubated with increasing amounts of human FN (Santa Cruz Biotechnology) (from 0 µg to 2 µg) ...
-
bioRxiv - Cell Biology 2024Quote: ... Human RARα siRNA (cat. #sc-29465, Santa Cruz Biotechnology, Santa Cruz, CA, USA); RARα antibody (cat ...
-
bioRxiv - Cell Biology 2023Quote: ... and Control CRISPR/Cas9 Plasmid (sc-418922) were purchased from Santa Cruz Biotechnology (Dallas ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR MEF cells were generated using Double Nickase Plasmid (Santa Cruz Biotechnology) against mouse Nir2 and Nir3 genes ...
-
bioRxiv - Neuroscience 2019Quote: ... The membrane was then probed with an anti-human HRP conjugated antibody (Santa Cruz) diluted in TBS.T with 5% non-fat milk powder ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the primary antibodies anti-CD45 (rabbit anti-human; Santa Cruz #sc-25590) and anti-Sema7A (mouse anti-human ...
-
bioRxiv - Immunology 2019Quote: ... the membrane was incubated with anti-human ACAT (1:200 dilution, SOAT; Santa Cruz) or anti-human pY641-STAT6 (1:200 dilution ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... After overnight incubation with primary antibody (EphA2 mouse anti-human, sc-398832, Santa Cruz) at 1:500 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... an anti-human Cyclin B1 rabbit antibody (1:100 dillution) (Santa Cruz Biotechnology, Inc.), an anti-hamster Cyclin B1 mouse monoclonal antibody (1:1000 dilution ...
-
bioRxiv - Microbiology 2020Quote: The monoclonal anti-human CD45 antibody (clone S5-Z6, Santa Cruz Biotechnology, Dallas, TX) was used for flow cytometry (1 ug/ 1 x106 cells) ...
-
bioRxiv - Microbiology 2022Quote: ... primary antibody mouse polyclonal anti–human E-cadherin (sc-8426, Santa Cruz Biotechnology, USA) in PBS–3% BSA that was incubated for 2 h at RT ...
-
bioRxiv - Neuroscience 2022Quote: hBECs and mBECs were transfected with human CD2AP siRNA (Santa Cruz Biotechnology, sc-29984) and mouse CD2AP siRNA (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... using the primary antibody mouse anti-human g91-phox (Santa Cruz Biotechnologies, sc-130543) with a 1:100 dilution ...
-
bioRxiv - Cell Biology 2023Quote: Primary antibodies were as follows: mouse anti-human BLM (sc-365753, Santa Cruz Biotechnology) at 1:250 (IF) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human FAK (rabbit polyclonal, A-17, Santa Cruz, sc-557; WB 1:250), anti-human kindlin2 (mouse monoclonal ...
-
bioRxiv - Neuroscience 2024Quote: ... lentiviral particles against no know human mRNA were used (sc-108080, Santa Cruz Biotech.). Lentiviral production for over-expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... WRN double-nickase plasmid (h) (sc-401860-NIC) was purchased from Santa Cruz. N/Tert-1 and N/Tert-1+HPV16 WRN–/– pools were generated as described for the SIRT1 knockout cells (26).
-
bioRxiv - Molecular Biology 2021Quote: ... we used a CRISPR-Cas9 approach with commercially available plasmids from Santa Cruz Biotechnology (sc-404395 and sc-404395-HDR ...
-
bioRxiv - Neuroscience 2022Quote: ... into 130 μl of plasmid transfection medium (Santa Cruz Biotechnology ®, sc-108062); Solution B was made by adding 10 μl of Ultracruz® transfection reagent (Santa Cruz Biotechnology ® ...
-
bioRxiv - Neuroscience 2022Quote: ... into 140 μl of plasmid transfection medium (Santa Cruz Biotechnology ®, sc-108062). Both solutions were left at RT for at least 5 minutes and were subsequently combined ...
-
bioRxiv - Immunology 2024Quote: ... Mouse cosmc guide RNA and CRISPR/Cas9 plasmid were obtained from Santa Cruz Technology (sc-425587) ...
-
bioRxiv - Cancer Biology 2024Quote: ... then added to 150 μl Plasmid Transfection Medium (Santa Cruz Biotechnology, sc-108062). A separate solution of 5 μl UltraCruz Transfection Reagent (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... the clean reads were mapped to human reference genome hg19 (University of California, Santa Cruz) by using Bowtie231 with default settings ...
-
bioRxiv - Biochemistry 2019Quote: Anti-human-SLN N-15 is an affinity-purified goat pAb (Santa Cruz Biotechnology, Inc.). The immunogen was a N-terminal peptide of human SLN (proprietary peptide sequence) ...
-
bioRxiv - Immunology 2021Quote: ... catalog# 16744-1-AP) and anti-human IL15 monoclonal antibody (1:10 dilution; Santa Cruz Biotechnology ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... while the unconjugated mouse-anti-human-FPR2 antibody was from Santa Cruz (Dallas, TX, USA). Triton X-100 was from Merck (Darmstedt ...