Labshake search
Citations for Santa Cruz :
601 - 650 of 7661 citations for 7 Bromo 2 tert butyl imidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1ug of C/EBP beta Antibody (H-7) sc-7962 (Santa Cruz Biotechnology) was used per sample and one control sample was treated in parallel with 1 μl of CUTANA Rabbit IgG CUT&RUN Negative Control Antibody ...
-
bioRxiv - Plant Biology 2020Quote: ... AmericanBio cat# AB01185) with or without appropriate antibiotics (15 μg/mL ammonium glufosinate (Santa Cruz Biotechnology, cat# 77182-82-2) for vectors pB7-HFN and pB7-HFC ...
-
bioRxiv - Neuroscience 2021Quote: ... Sheared chromatin (sonicated to 200–500 bp) from 2 × 106 mouse NSCs was incubated with 4μg of Goat THAP1 (sc-98174, Santa Cruz), 4μg of Rabbit YY1 (sc-98174 ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP and mCherry were probed with either mouse monoclonal anti-GFP antibody conjugated to HRP (B-2, Santa Cruz Biotech) or mouse monoclonal anti-mCherry TrueMAB™ antibody conjugated to HRP (OTI10G6 ...
-
bioRxiv - Cell Biology 2021Quote: ... (2) Quantitative western blot analysis of the complex was performed using a directly labeled 488nM anti-GFP antibody (Santa Cruz). The fluorescence intensity at 488 nm was quantified using an Amersham™ Typhoon Scanner and analyzed with ImageJ ...
-
bioRxiv - Cancer Biology 2019Quote: ... The blocked membranes were then incubated overnight at 4 °C with primary antibodies against O-GlcNAc (CTD 110.6 or RL-2, Santa Cruz), arginase-1 (clone H52 ...
-
bioRxiv - Plant Biology 2020Quote: ... AmericanBio cat# AB01185) with or without appropriate antibiotics (15 μg/mL ammonium glufosinate (Santa Cruz Biotechnology, cat# 77182-82-2)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... UMUC1 (2×105) cells were transfected with 2.5 mg of HNF-3alpha CRISPR/Cas9 KO plasmid (Santa Cruz, sc-400743) using lipofectamine3000 (Thermo fisher scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were fixed in 2% formaldehyde solution by adding equal amount of 4% formaldehyde (Santa Cruz Biotechnology, cat# sc-281692) directly in the culture media and incubated for 20 minutes at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... PLGA-PEG (100 mg) was dissolved in acetonitrile (2 mL) with either edaravone (100 mg; Santa Cruz Biotechnology, Dallas, TX) for Eda-MNPs ...
-
bioRxiv - Developmental Biology 2019Quote: TCam-2 cells were transfected with 40 nM siRNA mixture of 3 different KIF18A sequences (Santa Cruz Biotechnology, sc-96629), PUM1 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were cultivated four days in the presence of 2.5 μM D-threo-l-phenyl-2-palmitoylarmino-3-morpholino-l-propanol (PPMP; Santa Cruz) to inhibit synthesis of glucosylceramide-based GSLs [41].
-
bioRxiv - Biochemistry 2022Quote: ... while actin was labeled with the C-2 mouse mAb (both from Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). As a secondary antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Phage lysates were treated for 2 hr at 37°C either with 0.01 M methyl methanesulfonate (MMS) (Santa Cruz Biotechnology) or equal volume of phage buffer (100 μM Tris pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... media was removed and cells incubated with 20 mL of PBS containing 2 mM disuccinimidyl glutarate (DSG) (Santa Cruz Chemical) for 20 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... then soaking the gel for 2 hr with shaking in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate (Santa Cruz Biotech). The gel was then turned 90° and electrophoresed in the orthogonal direction at 130 V for 60 min in 1X TBE supplemented with 4.5 mg/mL chloroquine phosphate ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mg protein extract was used for immunoprecipitation and incubated with protein G beads and 4 μg mouse anti-GFP antibody (B-2 #sc-9996, Santa Cruz). Western blotting (Fig ...
-
bioRxiv - Immunology 2019Quote: ... and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS: sc-400769-HDR-2, RIG-I: sc-400812-HDR, both Santa Cruz). The knockout plasmids are a mixture of three plasmids ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were plated in 48-well plates (2×105 cells/well in 600μL) and mixed with polybrene (Santa Cruz Biotechnology, 134220) to a final concentration of 4μg/mL and 100-200μL undiluted lentiviral supernatant ...
-
bioRxiv - Biochemistry 2020Quote: ... GβL (sc-425272) and SUMO1/2/3 deletion were carried out in striatal cells using CRISPR/Cas-9 tools obtained from Santa Cruz, as described before [46 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pfeiffer and Karpas-422 were transduced by spinfection at 1,070 x g (5 acceleration, 2 brake) for 90 min at 37 °C with 8 µg/ml polybrene (Santa Cruz Biotechnology). After 48 h post-transduction ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was blocked with 5% milk/PBS for 2 h before incubation with mouse monoclonal anti-HA antibody (Sc-7392, Santa Cruz) at 1:10,000 for overnight at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Respective cells were incubated with anti-c-Myc antibody (9E10, mouse monoclonal, 2 mg/ml; Santa Cruz Biotechnology, Dallas, TX, USA) for 1 h at room temperature ...
-
bioRxiv - Pathology 2020Quote: ... Transfected cells were selected by selection media containing 2 μg/ml puromycin dihydrochloride (cat. no. sc-108071; Santa Cruz Biotechnology, Inc.). After confirming the decrease in LOXL2 expression by reverse transcription-quantitative polymerase chain reaction (RT-qPCR ...
-
bioRxiv - Pathology 2020Quote: ... HK-2 cells were treated with media containing 5 μg/ml of polybrene (cat. no. sc-134220; Santa Cruz Biotechnology, Inc.), and then LOXL2 shRNA lentiviral particles and control shRNA lentiviral particles of 1 and 2 multiplicity of infection (MOI ...
-
bioRxiv - Genetics 2019Quote: ... then incubated in primary antibody in 1% (w/v) skimmed milk in PBS at the following concentrations for 2-20 h at 4°C (anti-Srs2, Santa Cruz sc-1191 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the mem branes were incubated for 2 h at 37 °C with peroxidase conjugated secondary antibodies against r abbit IgG (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... for EGFP-tagged Vpu/F1/F2 detection, Nef antibody (EEH1, NIH AIDS Reagent Program) and anti-HA antibody for HA-tagged BST-2 protein (Santa Cruz). Secondary antibodies conjugated to HRP (Calbiochem ...
-
bioRxiv - Cell Biology 2021Quote: ... INSR was immunoprecipitated by incubating 500 μg of protein lysate with 2 μg INSR antibodies (Rabbit pAb, Cat. #sc-711, Santa Cruz) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pre-cleared chromatin was incubated with 2μg anti-Survivin (Tang, Ling, et al (2012) BBRC 421(2) 249-254) (10811, Santa Cruz Biotechnology), anti-H3K27ac (C15410196 ...
-
bioRxiv - Biophysics 2022Quote: Transcription induction of the transfected construct was done 24 h after transfection using 2 μg/mL doxycycline (Santa Cruz # sc-204734B) in Tet-free medium ...
-
bioRxiv - Cell Biology 2022Quote: ... sc-17787), rabbit polyclonal anti-HDAC6 (sc-11420), and mouse monoclonal anti-GFP (B-2, sc-9996) were obtained from Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transcription factor ChIP-Seq was performed as previously described11 with 2-5 ug of antibody was used per immunoprecipitation (POU2F2, sc-233X, Santa Cruz; POU2AF1 ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSC-CMs were resuspended in replating media (RPMI plus B27 supplement with 2% FBS and 5µM Y-27632 (Santa Cruz Biotechnology)) and 125,000 cells were seeded per fibroTUG substrate through the top of the cell seeding mask in approximately 200 µL of media ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (Cat# SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (Cat# SC-217100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... All samples and standards had a heavy isotope-labeled nucleoside mix added prior to mass spectral analysis (2′-deoxycytidine-13C1, 15N2 (#SC-214045, Santa Cruz), 5-(methyl-2H3)-2′-deoxycytidine (#SC-217100 ...
-
bioRxiv - Neuroscience 2024Quote: ... SMAD and Wnt inhibition were discontinued after D3 and the neurons were matured with daily medium changes involving 10µM N-[2S-(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl-1,1-dimethylethyl ester-glycine (DAPT; Santa Cruz Biotechnology, SC-201315A), neurotrophic factors (brain-derived neurotrophic factor (BDNF ...
-
bioRxiv - Immunology 2021Quote: ... mouse monoclonal anti-UBA7 (anti-UBE1L B-7; Santa Cruz Biotechnology Cat# sc-390097), rabbit anti-USP18 (Cell Signalling Technology Cat# 4813S) ...
-
bioRxiv - Cell Biology 2021Quote: ... the HA-probe (F-7) mouse monoclonal antibody was used (Santa Cruz, sc-7392). For the detection of ubiquitin ...
-
bioRxiv - Cell Biology 2020Quote: ... and for Sirt1KO with 2 Double Nickase plasmids each containing a different sgRNA to target sequences 148 CGGACGAGCCGCTCCGCAAG and 110 CCATGGCGGCCGCCGCGGAA (Santa Cruz Biotechnology). For control cells ...
-
bioRxiv - Genetics 2019Quote: ... Proteins were separated by SDS-PAGE and detected via Western blot following blocking (in TBS-0.1% Tween-20 with 5% non-fat milk powder) with the following antibody dilutions in the same blocking solution: α-GFP-HRP (B-2, sc-9996, Santa Cruz), 1:5000 ...
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... was used to collect leaf discs from the inoculation sites three weeks after PVX inoculation for immunoblot with anti-GFP (B-2, sc9996 HRP, Santa Cruz Biotechnology). GFP accumulation was visualised with Pierce™ ECL Western (32106 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 mg of lysate were incubated overnight with 2 μg of anti-HA-tag or control mouse IgG antibody (sc-2025, Santa Cruz Biotechnology) at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... The membrane was incubated for 1h at room temperature in blocking buffer (5% nonfat milk in PBS pH 7.4 containing 0.1% Triton X-100 and 0.02% NaN3) and immunoblotted for 2 h at room temperature with antibodies raised against insulin (Santa Cruz Biotechnology Inc, Santa Cruz, CA), the porosome associated protein ATP2C1 and actin (Santa Cruz Biotechnology Inc ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 2.2) for two times and applied for the immunodetection of phosphorylation levels by using an anti-pSer primary antibody (Santa Cruz, USA) and antimouse secondary antibody (Santa Cruz ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by secondary antibodies tagged with Alexa Fluor® 488 or Alexa Fluor® 568 at room temperature for 30 minutes and 4,6-diamidino-2-phenylindole (Santa Cruz). All samples were assessed under a fluorescence microscope (Leica Microsystem ...
-
bioRxiv - Cell Biology 2021Quote: ... The SCG section was incubated with the mouse monoclonal anti-TIGAR (E-2) Alexa Fluor 488 (sc-166290 AF488, Santa Cruz Biotechnology) and Goat polyclonal anti-VChAT (Cat# 24286 ...
-
bioRxiv - Immunology 2022Quote: ... Blotted proteins were detected with a rabbit polyclonal antibody that recognizes SARS-CoV-2 spike RBD (40592-T62, SinoBiological) and a donkey anti-rabbit IgG-HRP antibody (sc-2077, Santa Cruz Biotechnology).
-
bioRxiv - Cell Biology 2022Quote: ... The following antibodies were used: anti–pERK1/2 (E-4; sc-7383) and anti– β-actin (C4; sc-47778) from Santa Cruz Biotechnology ...