Labshake search
Citations for Becton, Dickinson and Company :
551 - 600 of 5651 citations for Recombinant HIV 1 GP120 Protein His Avi tagged Biotinylated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Zoology 2019Quote: ... 1% yeast extract (BD Difco ...
-
bioRxiv - Developmental Biology 2019Quote: ... 1:800 (BD Biosciences) and anti-PALS1 ...
-
S-nitrosoglutathione reductase deficiency causes aberrant placental S-nitrosylation and preeclampsiabioRxiv - Physiology 2021Quote: ... eNOS (1:1000; BD Bioscience ...
-
bioRxiv - Microbiology 2019Quote: ... 1% agar (BD #214010) in 6-well plates (Fisher Scientific #08-772-49 ...
-
bioRxiv - Cancer Biology 2021Quote: ... flottilin-1 (BD, 610820), anti-RFP (Rockland Immunochemicals ...
-
bioRxiv - Immunology 2022Quote: ... GolgiStop (1:800, BD), and GolgiPlug (1:800 ...
-
bioRxiv - Cell Biology 2022Quote: ... Opa1 (1:1000, BD Transduction laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... CD3ε (1:1000; BD Biosciences ...
-
bioRxiv - Cancer Biology 2022Quote: ... PD-1 (BD, 561272), LAG-3 (BioLegend ...
-
bioRxiv - Immunology 2019Quote: ... and PD-1 (BD biosciences clone EH12.1 ...
-
bioRxiv - Pathology 2020Quote: ... MKI67 (1:100, BDBiosciences), POSTN (1:100 ...
-
bioRxiv - Neuroscience 2019Quote: ... LY6A (1:250; BD Bioscience ...
-
Preferred endocytosis of amyloid precursor protein from cholesterol-enriched lipid raft microdomainsbioRxiv - Neuroscience 2020Quote: ... caveolin (cav-1; BD Transduction Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... 1% yeast extract (BD™ ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:50 (BD, #610182); donkey anti-goat (Alexa Fluor 488) ...
-
bioRxiv - Immunology 2022Quote: ... 1 mg BrdU (BD) was injected intraperitoneally ...
-
bioRxiv - Cancer Biology 2023Quote: ... CtBP1 (1:1,000, BD Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... Flottilin-1 (BD; 610820); FLAG (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... αLy6C (1:300; BD Biosciences Cat# 563011 ...
-
bioRxiv - Immunology 2023Quote: ... αCD8a (1:300; BD Biosciences Cat# 741811 ...
-
bioRxiv - Cell Biology 2023Quote: ... Calcineurin (1:1000; BD Bioscience ...
-
bioRxiv - Cell Biology 2023Quote: ... β-actin (1:5000, BD Biosciences ...
-
bioRxiv - Immunology 2023Quote: ... αCD11b (1:800; BD Biosciences Cat# 612801 ...
-
bioRxiv - Immunology 2023Quote: ... αSiglecF (1:300; BD Biosciences Cat# 746668 ...
-
bioRxiv - Immunology 2023Quote: ... αCD11c(1:300; BD Biosciences Cat# 564080 ...
-
bioRxiv - Neuroscience 2023Quote: ... CtBP2 (1:1000, BD Biosciences Cat# 612044 ...
-
bioRxiv - Cancer Biology 2023Quote: ... CtBP2 (1:1000, BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fibronectin (1:1000, BD) and GAPDH (1:5000 ...
-
bioRxiv - Immunology 2024Quote: ... PD-1 (MIH4, BD). LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... CD43 (1:200, BD Pharmingen 562865 ...
-
bioRxiv - Bioengineering 2020Quote: ... at 5:1:1 concentration ratio before transferred into a 1 ml syringe with BD Luer-Lok (BD, 309628, NJ, USA). The syringe was then hanged vertically to allow cell settling by gravity for 10-15 min with no flow ...
-
bioRxiv - Neuroscience 2020Quote: ... one section out of ten was incubated with BrdU antibodies (BrdU, 1/1,000, CldU, 1/500, Accurate Chemical; IdU, 1/500, BD Bioscience). Bound antibodies were visualized with Cy3-goat anti-rat antibodies (1/1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... were grown in in Pro99 media supplemented with 5 g L-1 peptone and 1 g L-1 yeast extract (BD Difco). All heterotrophs were grown at 24 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... were subcutaneously inoculated with 1 × 106 LoVo or 2 × 106 LS180 cells in 1:1 mixture of PBS and matrigel (BD Biosciences) into lower right flank ...
-
bioRxiv - Immunology 2020Quote: ... A fixable Viability Dye (APC-eFluor780 1:200, 1:400) (eBioscience, Germany) or ViaProbe (7-AAD, 1:33) (BD Biosciences, Germany)) was used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... RORγt (AFKJS-9; PE, dil. 1:100) (eBioscience); CD25 (PC61; PerCP, dil. 1:400), CD103 (M290; PE, dil. 1:150) (BD Pharmingen); CD11b (M1/70 ...
-
bioRxiv - Pathology 2020Quote: ... KI67 (1/1000, 14-5698-82, Ebioscience), NANOG (1/200, 49035, cell signaling technology) and OCT3/4 (1/200, 561556, BD Biosciences). The next day ...
-
bioRxiv - Immunology 2019Quote: ... after which cells were stained with Fixable Viability Staining e780 (1:1000) and CD11B (M1/70) antibodies: CD11B-BV510 (Day 1 cells, 1:300, BD Biosciences), CD11B-Percp-Cy5.5 (Day 3 cells ...
-
bioRxiv - Immunology 2021Quote: ... as a negative control in the presence of αCD28/αCD49d co-Stim antibodies (1 μg ml−1) GolgiStop (containing Monensin, 2 μmol/L), GolgiPlug (containing brefeldin A, 10 μg ml−1) (BD Biosciences) and anti-CD107α BV421 antibody (BD Biosciences) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 x 106 parasites were collected and incubated with VSG2WT antisera (1:4000) or VSG11WT (1:1000) together with Fc block (1:200, BD Pharmingen) in cold HMI-9 without FBS for 10 min at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... The cOBBs were resuspended in 1:1 v/v ECM gel to cOBBs and transferred to a 1 mL disposable syringe (BD Biosciences). The cOBBs were centrifuged at 100g for 3 min and the supernatant removed ...
-
bioRxiv - Cancer Biology 2024Quote: ... bilateral subcutaneous dorsal flank tumors were established by injecting 1 × 106 cells suspended in a 1:1 mixture of serum-free medium and Matrigel (BD Biosciences). Once tumors reached an average volume of 100 mm3 ...
-
bioRxiv - Bioengineering 2024Quote: ... Viability dye was quenched by washing with FACS buffer (PBS + 2% FBS + 1 mM EDTA) before addition of surface staining antibodies in a 1:1 dilution of Brilliant Stain Buffer (BD 563794) in FACS buffer ...
-
bioRxiv - Bioengineering 2024Quote: ... and stained for 30 min on ice with surface antibodies at a 1:200 dilution in a 1:1 mixture of FACS buffer and Brilliant Stain Buffer (BD Biosciences). Cells were washed with FACS buffer and PBS and fixed with 2% paraformaldehyde on ice for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... We used three different antibodies: anti-DRBP76 (anti-double stranded RNA binding protein 76 or anti-NF90) antibody (BD Biosciences), N-terminus anti-EBP1 (Abcam) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies (anti-Cas9 7A9-3A3, Cell Signaling Technology #14697S, anti-γ-tubulin Sigma#T5326, anti-Human Retinoblastoma protein BD Pharmigen #554136 ...
-
bioRxiv - Cell Biology 2021Quote: ... conjugated anti-c-kit and Peridinin Chlorophyll Protein Complex (PerCP) or allophycocyanin (APC) conjugated anti-CD45 antibodies were purchased from BD Biosciences Pharmingen ...