Labshake search
Citations for Becton, Dickinson and Company :
3901 - 3950 of 8448 citations for Mouse Chitinase 1 CHIT1 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... bone marrow cells were stained using BD Stemflow™ Mouse Hematopoietic Stem and Progenitor Cell Isolation Kit (BD, 560492) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Microglia were isolated from the resulting cell suspension via immunopanning with the rat-anti-mouse CD45 antibody (BD, 553076) and the secondary goat-anti-rat antibody (Jackson ImmunoResearch ...
-
bioRxiv - Cell Biology 2024Quote: ... Antibodies and dyes used: VE-cadherin mouse monoclonal IgG1 antibody directly labeled with Alexa Fluor 647 (BD Biosciences, #561567), PECAM-1 non-blocking mouse monoclonal IgG1 antibody directly labeled with Alexa Fluor 647 (BD Biosciences ...
-
bioRxiv - Immunology 2024Quote: Monoclonal antibodies (mAb) against mouse CD40, CD90.2, B220 (CD45R), and other mAbs (purified, biotinylated, or fluorophore-conjugated) were from BD Biosciences or Tonbo Biosciences (San Diego CA ...
-
bioRxiv - Neuroscience 2024Quote: Anti-mouse antibodies used for flow cytometry included: rat anti-CD31 (MEC 13.3, BD Pharmingen, San Diego, CA, USA), rat anti-CD45-APC (30F11 ...
-
bioRxiv - Immunology 2024Quote: ... that was emulsified in CFA containing 200 μg/mouse Mycobacterium tuberculosis H37Ra (Becton, Dickinson and Company, Sparks, MD, USA). 80 ng of pertussis toxin (PTX ...
-
bioRxiv - Molecular Biology 2024Quote: The following commercially available primary antibodies were used in this study: mouse monoclonal anti-MYOD (BD Bioscience, Cat #554130), recombinant abflex anti-H3K27ac (Active Motif ...
-
bioRxiv - Immunology 2024Quote: ... The single cells were labeled with sample tags using the BD Mouse Immune Single-Cell Multiplexing Kit (633793; BD). Following standard protocols ...
-
bioRxiv - Physiology 2024Quote: ... 0.75 U of insulin/kg of mouse weight was injected via intraperitoneal injection using SafetlyGlide 31G insulin needles (BD). Blood glucose measurements were performed as described for the OGTT ...
-
bioRxiv - Genomics 2024Quote: ... Cells were subsequently stained with antibodies against CD19 (APC-Cy7 mouse anti-human CD19, BD Pharmingen, catalog no. 557791) and MAC1 (APC mouse anti-human CD11b/Mac1 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Red blood cell depletion from the placental suspensions were carried out using anti-Mouse Ter-119 antibody (BD Biosciences) was used.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were blocked in 5% w/v skim milk in TBS with 0.1% v/v Tween and immunoblotted for cytochrome c (mouse monoclonal antibody, clone 7H8.2C12, #556433, BD Biosciences) or HSP60 (rabbit polyclonal antibody ...
-
bioRxiv - Bioengineering 2020Quote: ... at 5:1:1 concentration ratio before transferred into a 1 ml syringe with BD Luer-Lok (BD, 309628, NJ, USA). The syringe was then hanged vertically to allow cell settling by gravity for 10-15 min with no flow ...
-
bioRxiv - Neuroscience 2020Quote: ... one section out of ten was incubated with BrdU antibodies (BrdU, 1/1,000, CldU, 1/500, Accurate Chemical; IdU, 1/500, BD Bioscience). Bound antibodies were visualized with Cy3-goat anti-rat antibodies (1/1,000 ...
-
bioRxiv - Microbiology 2022Quote: ... were grown in in Pro99 media supplemented with 5 g L-1 peptone and 1 g L-1 yeast extract (BD Difco). All heterotrophs were grown at 24 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... were subcutaneously inoculated with 1 × 106 LoVo or 2 × 106 LS180 cells in 1:1 mixture of PBS and matrigel (BD Biosciences) into lower right flank ...
-
bioRxiv - Immunology 2020Quote: ... A fixable Viability Dye (APC-eFluor780 1:200, 1:400) (eBioscience, Germany) or ViaProbe (7-AAD, 1:33) (BD Biosciences, Germany)) was used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... RORγt (AFKJS-9; PE, dil. 1:100) (eBioscience); CD25 (PC61; PerCP, dil. 1:400), CD103 (M290; PE, dil. 1:150) (BD Pharmingen); CD11b (M1/70 ...
-
bioRxiv - Pathology 2020Quote: ... KI67 (1/1000, 14-5698-82, Ebioscience), NANOG (1/200, 49035, cell signaling technology) and OCT3/4 (1/200, 561556, BD Biosciences). The next day ...
-
bioRxiv - Immunology 2021Quote: ... as a negative control in the presence of αCD28/αCD49d co-Stim antibodies (1 μg ml−1) GolgiStop (containing Monensin, 2 μmol/L), GolgiPlug (containing brefeldin A, 10 μg ml−1) (BD Biosciences) and anti-CD107α BV421 antibody (BD Biosciences) ...
-
bioRxiv - Microbiology 2023Quote: ... 1 x 106 parasites were collected and incubated with VSG2WT antisera (1:4000) or VSG11WT (1:1000) together with Fc block (1:200, BD Pharmingen) in cold HMI-9 without FBS for 10 min at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... and stained for 30 min on ice with surface antibodies at a 1:200 dilution in a 1:1 mixture of FACS buffer and Brilliant Stain Buffer (BD Biosciences). Cells were washed with FACS buffer and PBS and fixed with 2% paraformaldehyde on ice for 20 min ...
-
bioRxiv - Bioengineering 2024Quote: ... The cOBBs were resuspended in 1:1 v/v ECM gel to cOBBs and transferred to a 1 mL disposable syringe (BD Biosciences). The cOBBs were centrifuged at 100g for 3 min and the supernatant removed ...
-
bioRxiv - Cancer Biology 2024Quote: ... bilateral subcutaneous dorsal flank tumors were established by injecting 1 × 106 cells suspended in a 1:1 mixture of serum-free medium and Matrigel (BD Biosciences). Once tumors reached an average volume of 100 mm3 ...
-
bioRxiv - Bioengineering 2024Quote: ... Viability dye was quenched by washing with FACS buffer (PBS + 2% FBS + 1 mM EDTA) before addition of surface staining antibodies in a 1:1 dilution of Brilliant Stain Buffer (BD 563794) in FACS buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... and subsequentenly with primary antibodies (1/30 Ki-67 Cat. 550609 and 1/200 Anti BrdU Cat. 555627, both in 1% BSA, BD Pharmingen) overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were stained with the following antibody mixes for 1 hour at 4°C in the dark: Mix 1: AlexaFluor 700 anti-CD45 (1:150, BD Biosciences), AlexaFluor 647 anti-CD44 (1:100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... cells were washed again and re-suspended in permeabilization buffer with the following fluorescently-tagged antibodies targeting intracellular T-lymphocyte proteins for 30 min: IL-4 BV 421 (BD Biosciences clone 11B11 ...
-
bioRxiv - Biophysics 2020Quote: ... Positive cells were amplified under antibiotic selection pressure and sorted for low or intermediate expression level of the fluorescently tagged protein on an Aria II Fluorescence Activated Cell Sorter (BD). Each sorted population was then used for pilot experiments to determine the lowest possible expression level required for optimal imaging conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Genomics 2020Quote: ... Primary antibodies (anti-Cas9 7A9-3A3, Cell Signaling Technology #14697S, anti-γ-tubulin Sigma#T5326, anti-Human Retinoblastoma protein BD Pharmigen #554136 ...
-
bioRxiv - Cell Biology 2021Quote: ... conjugated anti-c-kit and Peridinin Chlorophyll Protein Complex (PerCP) or allophycocyanin (APC) conjugated anti-CD45 antibodies were purchased from BD Biosciences Pharmingen ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... To generate fluorescently tagged Env probes 2 μg of biotinylated Env protein was incubated with either 0.5 μg streptavidin-conjugated PE (BD Biosciences) or 0.5 μg streptavidin-conjugated BV786 (BD Biosciences ...
-
bioRxiv - Synthetic Biology 2022Quote: ... all samples were mixed 1:1 with prewarmed CytoFix Fixation Buffer (BDBiosciences #554655) and incubated at room temperature for 15 minutes ...