Labshake search
Citations for Becton, Dickinson and Company :
1551 - 1600 of 1658 citations for Recombinant Human LDLR protein GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... The following primary antibodies detected the proteins of interest: mouse anti-α-CaMKII (1:3000; BD, NJ, USA; 611292); rabbit anti-α-actin (1:3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... stimulation with GolgiStop solution being added for a total of 5 hours block intra-cellular protein transport (BD Bioscience). As a positive control for cytokine production ...
-
bioRxiv - Immunology 2021Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Prox1 and pErkT202/Y204 proteins were detected non-fluorescently using biotinylated goat anti-rabbit IgG (1: 400, BD Biosciences) followed by avidin-HRP and DAB detection (Vector labs ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were pre-stimulated with 100 ng/ml LPS together with protein transport inhibitor Golgi Plug (1:1000, BD) for 1hr at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the total protein was detected by using specific antibodies (AP2: mouse anti-AP2 μ2, BD Biosciences, 611351, (1:250), Actin ...
-
bioRxiv - Immunology 2024Quote: ... the intracellular expression of viral p27 Gag proteins was assessed by flow cytometry with a CytofixCytoperm kit (BD Biosciences). Antibodies used were as follows ...
-
bioRxiv - Microbiology 2023Quote: PBS-washed cells were immunostained for individual surface proteins using the following antibodies: anti-BST2/Tetherin-BV421 (#566381; BD), anti-CCR5/CD195-FITC (#555992 ...
-
bioRxiv - Immunology 2022Quote: ... Cells incubated with biotinylated monoclonal antibodies were incubated with fluorochrome-conjugated streptavidin–peridinin chlorophyll protein–cyanine 5.5 (551419; BD), streptavidin-allophycocyanin-Cy7 (554063 ...
-
bioRxiv - Molecular Biology 2024Quote: ... We stained intracellular proteins using the following antibodies: anti-mouse CD3 BUV737 (1:100, 17A2, BD Biosciences, Cat. 612803) and anti-mouse CD4 Alexa Fluor 700 (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... We processed the membrane for protein detection using antibodies against CD63 (1:1000; BD Biosciences, San Jose, California, USA), CD81 (1:1000 ...
-
bioRxiv - Genetics 2024Quote: ... BFP and GFP positive cells (indicative of successful delivery of protein and crRNA constructs) were sorted (BD FACSAria Fusion) and carried out for subsequent flow-cytometry experiments.
-
bioRxiv - Neuroscience 2024Quote: ... in flotation for 1 h at room temperature and then overnight at 4°C with the mouse antibody that recognizes protein GM130 (Cat# A-610822, RRID:AB_398141, BD Biosciences), followed by incubation for 2 h at room temperature with Alexa Fluor 546-conjugated goat anti-mouse secondary antibodies (Cat#A-11030 ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-glial fibrillary acidic protein (GFAP; 14-9892; eBioscience, 1:1000) FITC-Labelled anti-CD11c (553801; BD biosciences; 1:500) were used as primary antibodies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Immunology 2020Quote: ... CLTX-CAR T cells were incubated with GBM cells (E:T=1:1) for 5 h in the presence of CD107a antibody and GolgistopTM protein transport inhibitor (BD Biosciences). To test for CAR T cell killing potency ...
-
bioRxiv - Cancer Biology 2020Quote: ... and knockout success was examined by Sanger sequencing and Western blot to confirm protein loss (anti-CDH1 antibody, BD #610182). 8 clones with the least E-cadherin protein expression by immunoblot were then pooled in equal ratio and named T47D CDH1 KO ...
-
bioRxiv - Microbiology 2021Quote: ... from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD). AH109 yeast cells (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... conjugated anti-c-kit and Peridinin Chlorophyll Protein Complex (PerCP) or allophycocyanin (APC) conjugated anti-CD45 antibodies were purchased from BD Biosciences Pharmingen ...
-
bioRxiv - Immunology 2022Quote: ... Antibodies to intracellular proteins were added to samples for 20 minutes at 4°C in the dark and then washed with PermWash (BD). Flow cytometry analysis was performed using a LSRFortessa flow cytometer (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... 75μg of proteins from control and ALS post-mortem mCTX homogenates was incubated with 5μL anti-DRP1 (BD Bioscience, CA), and GAL4 immunoprecipitation buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1µM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilisation step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... between the NdeI or NcoI and BamHI restriction sites in order to express N-terminal fusion proteins with the GAL4 DNA binding domain (BD) or with the GAL4 activation domain (AD) ...
-
bioRxiv - Immunology 2021Quote: ... in the last 5 hours of culture a protein transport inhibitor Brefeldin A (1µL/mL) was added (BD Biosciences, USA). Cells were fixed using the BD Cytofix/Cytoperm® kit (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... T cells and tumor cells were co-cultured at a 1:1 effector to target (E:T) ratio for 5 hours in the presence of GolgiStop Protein Transport Inhibitor (BD Biosciences). Surface phenotype of cells was determined by flow cytometry using fluorochrome-conjugated antibodies specific for CD3 (Miltenyi Biotec ...
-
bioRxiv - Biochemistry 2020Quote: ... this threshold is likely a consequence of the fact that the target protein in all six ternary complex crystal structures is a bromodomain (BD), of either Brd4 ...
-
bioRxiv - Immunology 2021Quote: Organ homogenates were thawed and the resulting supernatants analyzed for cytokines and proteins by ELISA (Biolegend, BD, and R&D) and Luminex (R&D ...
-
bioRxiv - Immunology 2020Quote: ... 1–2 × 106 cells were incubated with 1 μM of SARS-CoV-2 minimal epitope or pool of up to ten epitopes (1 μM/peptide) for 9 h at 37°C in the presence of protein transport inhibitor (GolgiPlug; BD Biosciences ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Proteins were detected using anti-HA (Covance cat# MMS-101P, 1:1000) and anti-Actin (BD cat# 612657, 1:1000) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... The levels of IFNg protein expression was determined by intracellular staining after exposure to 4 hours of GolgiStop and GolgiPlug (BD).
-
bioRxiv - Immunology 2020Quote: ... IFN-γ and IL-4 protein in culture supernatants were quantified using the Cytokine Bead Array according to the manufacturer’s instructions (BD Biosciences)
-
bioRxiv - Biochemistry 2024Quote: ... AtHSP90-3 and ASDURF were transferred to the pGADT7-GW and pGBKT7-GW destination vectors using Gateway LR Clonase II enzyme mix to produce fusion proteins of the Gal4-activation domain (AD) and GAL4 DNA-binding domain (BD), respectively ...
-
bioRxiv - Immunology 2024Quote: ... cells were treated for 5 hours with a protein transport inhibitor containing brefeldin A (BD Biosciences, Franklin Lakes, NJ, USA), washed and fixed for 10 minutes at 4°C with fixation/permeabilization solution (BD Cytofix/Cytoperm kit ...
-
bioRxiv - Immunology 2023Quote: ... Intracellular staining for cytoplasmic and nuclear proteins were performed with Transcription Factor Staining Buffer kit according to manufacturer’s instructions (BD Pharmingen). Dead cells were excluded by DAPI (BioLegend ...
-
bioRxiv - Developmental Biology 2024Quote: ... Membranes containing the transferred proteins were rinsed and blocked in 0.1% Tween-20 in Tris-buffered saline (TBST) containing 5% nonfat milk (BD Biosciences) at RT for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were stained with antibodies specific for intracellular proteins (Supplemental Table 1) (1:100,v/v) in Perm/Wash buffer (BD) supplemented to contain 2% rat serum at RT for 1 hour ...
-
bioRxiv - Immunology 2020Quote: Multiscreen ninety-six well plates were coated overnight with 100 μl per well of 5 μg/ml anti-human interferon-γ (IFN-γ) (B27; Becton, Dickinson and Company, Franklin Lakes, NJ) in endotoxin-free Dulbecco’s-PBS (D-PBS) ...
-
bioRxiv - Bioengineering 2024Quote: ... for 10 min at room temperature and then stained for 30 min at 4°C with the following antibody cocktail: anti-human CD19 (Becton, Dickinson and Company, BD, Franklin Lakes, NJ, USA, cat.: 562440), anti-human CD20 (BioLegend ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein concentration was determined by BCA assay and 250 µg protein lysates were incubated with anti-Myc (2.5 µg, BD Pharmingen 551102) or anti-IgG (2.5 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... and macrophage chemoattractant protein-1 (MCP-1) were quantified by bead-based flow cytometry assay (CBA Kit; BD Biosciences, Heidelberg, Germany) in accordance with the instructions of the manufacturer.
-
bioRxiv - Molecular Biology 2021Quote: ... run on PAGE together with input sample (1:20 of amount of immunoprecipitated proteins) and blotted with anti-PARP1 (Mouse Mab 551025 BD Pharmigen), anti-TRF1 (Rabbit Pab sc-6165 ...
-
bioRxiv - Microbiology 2022Quote: ... was used as a secondary antibody. Surface expression level of S proteins (Extended Data Fig. 6a) was measured using FACS Canto II (BD Biosciences) and the data were analysed using FlowJo software v10.7.1 (BD Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... High sensitivity C-reactive protein (CRP) was measured in serum: blood was collected into a silica and gel containing tube (BD Vacutainer).
-
bioRxiv - Immunology 2022Quote: ... cells were stimulated for 4 h with eBioscience™ Cell Stimulation Cocktail and a protein transport inhibitor-containing Brefeldin (1.5uL/mL StopGolgi; BD Biosciences). Cells were then washed in FACS buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were then left unstimulated or stimulated with 50 ng/mL PMA and 1uM Ionomycin for 7 hours in the presence of a protein transport inhibitor (BD GolgiPlugTM, BD Biosciences). To stain for intracellular cytokines cells were washed with PBS supplemented with 3% FBS followed by a fixation and permeabilization step with FIX & PERM Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The proteins of interest were visualized after incubation with primary antibodies (α-synuclein 1:1000 BD Biosciences (San Jose, CA, USA) #610787 ...
-
bioRxiv - Systems Biology 2020Quote: ... cells were extensively washed with PBS and stained with NeutrAvidin Protein DyLight 488 1:50 for 20 min prior analysis using an Accuri C6 Flow Cytometer (BD Biosciences) with side-scatter (height ...
-
bioRxiv - Cell Biology 2022Quote: ... Green fluorescent protein (GFP) positive cells in HRasL61 with GFP transfected cells were sorted using flow-cytometry (FACS Aria II; BD Bioscience).
-
bioRxiv - Physiology 2022Quote: The geometric mean fluorescence intensities (MFI) corresponding to the probes/target protein levels were determined by flow cytometry acquired on Aria II (BD Biosciences) or CytoFLEX (Beckman Coulter ...