Labshake search
Citations for Becton, Dickinson and Company :
901 - 908 of 908 citations for Rat ERICH6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Mtb strain H37Rv with plasmid pSMT3[Phsp60/DsRed] [9] was cultured at 37°C in complete Difco Middlebrook 7H9 Broth (BD Biosciences), supplemented with 10% ADC (BD Biosciences) ...
-
bioRxiv - Microbiology 2023Quote: Stm strain SL1344 with plasmid pMW211[C.10E/DsRed] [20] and strain 12023 with plasmid pluxCDABE [6] were recovered from frozen glycerol stock and cultured in Difco Luria-Bertani (LB) Broth (BD Biosciences) containing 100 µg/ml ampicillin (Merck ...
-
bioRxiv - Genomics 2022Quote: ... single cells expressing GFP (expressed from the CRISPR plasmid) were sorted into 96-well plates through flow cytometry using a BD FACSAria Fusion (BD Biosciences). Single-cell clones were cultured and tested for successful knockout of RFX7.
-
bioRxiv - Cell Biology 2024Quote: ... organoids were dissociated and mCherry positive cells (marking successful electroporation of the pCAS9-mCherry-Frame+1 plasmid) were sorted on ARIAIII sorter (BD Biosciences) and seeded in Matrigel with normal organoid media supplemented with rock inhibitor Y-27632 (10 μM) ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Cell Biology 2021Quote: ... The ZsGreen-ODC (ornithine decarboxylase) cells were previously generated by transfection of MelJuSo cells with the ZsProsensor-1 plasmid (BD Bioscience Clontech)20 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% dextrose) when containing no plasmids and in synthetic defined (SD) media (0.67% yeast nitrogen base without amino acids [BD Difco], 2% dextrose) supplemented with the appropriate yeast synthetic drop-out medium supplement when plasmid maintenance was required (SDΔW-without tryptophan ...