Labshake search
Citations for Becton, Dickinson and Company :
701 - 750 of 1651 citations for rno mir 137 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... CytoFix/CytoPerm and Perm/Wash Buffer kit (BD, 554714) was used for intracellular staining steps ...
-
bioRxiv - Bioengineering 2022Quote: ... IFNγ and TNFα ELISA kit were purchased from BD Biosciences (San Jose ...
-
bioRxiv - Immunology 2022Quote: ... fixed and permeabilized with Cytofix/Cytoperm kit (BD Biosciences) prior to acquisition using FACSymphony ...
-
bioRxiv - Immunology 2023Quote: ... by using Cytofix/CytoPerm Plus kit (555028; BD Pharmingen). Samples were analyzed using a Fortessa flow cytometer (BD Biosciences) ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using the Fixation/Permeabilization Kit (BD Biosciences #554714), and stained intracellularly ...
-
bioRxiv - Immunology 2023Quote: ... permeabilized using a Cytofix/Cytoperm solution kit (BD Biosciences), and intracellularly stained with anti-TNF-Alexa 700 (alone MAB11) ...
-
bioRxiv - Immunology 2023Quote: ... FITC-anti-BrdU (BD, BrdU flow kit, Cat#559619), Zombie Aqua fixable viability kit (BioLegend ...
-
bioRxiv - Pathology 2023Quote: ... WBC were quantified using the Leucocount Kit (BD, 340523). Platelet unit pH was measured daily by adding 25 μL of the platelet unit to pH strips with a pH range of 5-9 (Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... labeled with Mouse Immune Single-Cell Multiplexing Kit (BD) and loaded on a microwell cartridge of the BD Rhapsody Express system (BD ...
-
bioRxiv - Immunology 2024Quote: ... or Cytofix/Cytoperm Fixation/Permeabilization Solution Kit (BD Bioscences). Final flow cytometry gating strategy for SFCs and PBMCs shown in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed using BD Cytofix kit (BD #554655) following manufacturer’s instructions and acquired on analyzer within 3 days of fixation ...
-
bioRxiv - Molecular Biology 2024Quote: ... cDNA was generated using the cDNA kit from BD. Libraries were prepared using the whole transcriptome analysis (WTA ...
-
bioRxiv - Immunology 2024Quote: ... and processed using BD Rhapsody Cartridge Reagent Kit (BD) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-GFP plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and GFP from pEGFP-N1 (BD Biosciences Clontech) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Cancer Biology 2021Quote: Cell cycle analysis was performed using the BrdU Flow Kit according to the manufacturer protocol (BD, FITC BrdU Flow Kit; Cat. No. 559619), with cells pulsed with BrdU for 1 hour at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: pEU-E01 cell-free wheat germ expression vector containing ampicillin resistance and cell-free wheat germ expression kit (Cat# CFS-CPLE-BD Proteoliposome BD Kit) were obtained from CellFree Sciences Co. ...
-
bioRxiv - Immunology 2021Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2019Quote: ... HSPCs were stained using c-Kit-APC (2B8; BD Biosciences), Sca-1-Cy7PE (D7 ...
-
bioRxiv - Bioengineering 2019Quote: ... Monocytes were enriched by using monocytes enrichment kit (BD biosciences) according to the manufacture instructions ...
-
bioRxiv - Immunology 2019Quote: The Cytokine Bead Array Mouse Inflammation kit (BD Biosciences 552364) was used according to manufacturer’s instructions for simultaneous measurement of IL-6 ...
-
bioRxiv - Immunology 2020Quote: ... cells were processed using the Fixation/Permeabilization kit from BD Biosciences (BD Cytofix/Cytoperm ...
-
bioRxiv - Immunology 2019Quote: ... Cells were permeabilised with Cytofix/Cytoperm kit (BD Biosciences, USA) accordingly to the manufacturer protocol and stained with monoclonal antibodies targeting IFN-γ (BD Bioscience ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by mild fixation and permeabilization using the Cytofix and Cytoperm solutions from BD Cytofix/Cytoperm™ Fixation/ Permeabilization Solution Kit (BD biosciences, BDB554714) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then analyzed with BrdU-APC Flow Kit (BD Biosciences) as described previously (24).
-
bioRxiv - Molecular Biology 2021Quote: ... BD Cytofix/Cytoperm™ kit (BD Biosciences, San Jose, CA) was used following the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... fixed and permeabilized using Fixation/Permeabilization Solution Kit (BD Biosciences) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and stained using a PE BrdU flow kit (BD Biosciences). For coculture experiments and proliferation experiments ...
-
bioRxiv - Immunology 2019Quote: ... Barcoded oligo-conjugated antibodies (single-cell multiplexing kit; BD Biosciences) were used to infer origin of sample (ie ...
-
bioRxiv - Neuroscience 2021Quote: The cytokine bead array mouse inflammation kit (BD Biosciences, USA) was used for the determination of cytokine levels in brain lysate and plasma samples according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... followed by permeabilization with Cytofix/cytoperm kit solution (BD Biosciences) and staining with anti-IFN-γ (BD Biosciences Cat#554702) ...
-
bioRxiv - Immunology 2020Quote: ... fixed and permeabilized with the Cytofix/Cytoperm Kit (BD Biosciences), and stained for intracellular IFNγ using APC-XMG1.2 (eBioscience).
-
bioRxiv - Immunology 2020Quote: ... fixed and permeabilized with an intracellular cytokine staining kit (BD) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... permeabilized with cytofix/cytoperm Kit (BD Biosciences, Cat. no: 554714), and then stained with anti-Ki-67 antibody ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed using fixation solution (BD, FoxP3 staining kit) for 30 min and washed twice using FACS buffer ...
-
bioRxiv - Microbiology 2021Quote: Infected cells were fixed with cytofix/cytoperm kit (BD Pharmingen) and stained using the indicated primary and secondary antibodies ...
-
bioRxiv - Immunology 2021Quote: ... and stained according to BD Cytofix/Cytoperm Kit (BD Biosciences) or the FoxP3/Transcription Factor Staining Buffer Set (Thermo Fisher).
-
bioRxiv - Immunology 2021Quote: ... fixed and were stained with Phosflow staining kit from BD Biosciences using manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... fixed and permeabilized using the cytofix/cytoperm kit (BD Biosciences), and intracellularly stained for IFN-γ ...
-
bioRxiv - Immunology 2022Quote: ... Barcoded oligo-conjugated antibodies (single-cell multiplexing kit; BD Biosciences) were used to infer the origin of sample (i.e ...
-
bioRxiv - Microbiology 2024Quote: ... and fixed/permeabilized with the Cytofix/Cytoperm kit (BD Bioscience). Cells were then stained for 30min on ice with Alexa-Fluor-488-conjugated mouse monoclonal antibody (mAb ...
-
bioRxiv - Cancer Biology 2024Quote: The BD Pharmingen™ APC BrDU Kit (BD Biosciences, #552598) was used as per the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-KIT rat monoclonal antibody (BD Biosciences, 553352, 1:200), anti-DDX4 rabbit polyclonal antibody (abcam ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were fixed with Cytofix/Cytoperm Fixation/Permeabilization Kit (BD) for 10 minutes at room temperature followed by 10 minutes incubation with Perm/Wash buffer ...
-
bioRxiv - Immunology 2024Quote: ... or the BD fixation/permeabilization solution kit (#554714, BD BioSciences) according to the manufacturer’s protocols and then incubated with a cocktail of antibodies against intracellular markers ...
-
bioRxiv - Immunology 2024Quote: ... cells were permeabilized using the Cytofix/Cytoperm kit (BD Biosciences) and incubated with intracellular antibodies ...
-
bioRxiv - Immunology 2023Quote: ... and processed using BD Rhapsody™ Cartridge Reagent Kit (BD) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed in BD Cytofix/Cytoperm kit (BD Biosciences) for 10 minutes and intracellular proteins were subsequently stained overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... except cells were permeabilized using Cytofix/Cytoperm kit (BD Biosciences) before adding the antibodies and during the following procedure ...
-
bioRxiv - Immunology 2023Quote: ... cells were permeabilized using the Cytofix/Cytoperm kit (BD Biosciences), and incubated with intracellular antibodies ...