Labshake search
Citations for Becton, Dickinson and Company :
551 - 600 of 1550 citations for rno mir 137 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... anti-KIT (all from BD Biosciences), anti-TSPAN33 ...
-
bioRxiv - Immunology 2024Quote: ... performed using a kit (BD Biosciences), allows the simultaneous detection and quantification of soluble murine IFN-γ ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the Cytofix/Cytoperm kit (BD), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Cytofix/Cytoperm™ kit (BD biosciences) was used for intracellular stainings by following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The Cytofix/Cytoperm Kit (BD Biosciences) a used for intracellular staining ...
-
bioRxiv - Neuroscience 2020Quote: ... Explants were grown on 12-mm diameter glass coverslips coated with 20 μg/mL laminin for 2D cultures used for time-lapse imaging or coated with 7 μl of Matrigel™ (BD Biosciences, Mississauga, ON, Canada) for 3D cultures used for morphological analysis ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were fixed and permeabilized using a kit based on saponin permeabilization (Fixation/Permeabilization Solution Kit, BD) following a protocol described by Schauer U ...
-
bioRxiv - Genetics 2019Quote: ... DNA was amplified by PCR and fragments of inappropriate sizes were removed using Agencourt AMPure XP beads (BD). Finally ...
-
bioRxiv - Genetics 2019Quote: ... DNA was amplified by PCR and fragments of inappropriate sizes were removed using Agencourt AMPure XP beads (BD). Finally ...
-
bioRxiv - Immunology 2021Quote: ... and anti-inflammatory cytokines (IL-10, TGF-β) were determined in plasma by ELISA at the indicated time points (OptEIA set; BD Biosciences, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... taken approximately at the time of feed delivery via puncture of coccygeal vessels using two-10mL evacuated tubes with serum separator (BD Vacutainer; Becton, Dickinson and Company, Franklin Lakes, NJ). Blood samples that were collected within 2 days of actual calving date were not considered as the -1 wk point to avoid changes in blood biomarkers due to the hormonal changes associated with calving ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Cytofix/Cytoperm Kit (BD Biosciences). After two washing steps ...
-
bioRxiv - Cancer Biology 2021Quote: ... TACS Annexin V-FITC Kits (BD Biosciences) were utilized to measure apoptosis ...
-
bioRxiv - Cell Biology 2021Quote: APC BrdU Flow Kit (BD Biosciences #552598) was used according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse inflammation CBA kit was from BD Biosciences ...
-
bioRxiv - Cancer Biology 2021Quote: ... or Fixation/Permeabilization Solution Kit (BD Biosciences). Samples were Fc-blocked for 10 min using TruStain fcX (BioLegend) ...
-
bioRxiv - Immunology 2021Quote: ... Fixation/Permeabilization Solution Kit (554714; BD Biosciences) was used according to the manufacturer’s protocol to detect total (surface and intracellular ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were Gram-stained (BD Kit 212524) and visualized at 40-80x magnification using an Olympus BX60 compound microscope.
-
bioRxiv - Immunology 2020Quote: ... Following ELISA kits were brought from BD: Mouse-IL-6 (OptEIA™-555240 ...
-
bioRxiv - Microbiology 2022Quote: ... and the Fixation/Permeabilization kit from BD Biosciences was used (Cat n° 554714) ...
-
bioRxiv - Microbiology 2022Quote: ... and the Fixation/Permeabilization kit from BD Biosciences was used (Cat n° 554714) ...
-
bioRxiv - Immunology 2022Quote: ... using a Cytofix/Cytoperm kit (BD Biosciences) in accordance with manufacturers recommendations ...
-
bioRxiv - Bioengineering 2020Quote: ... and a colorimetric kit (BD Biosciences, 555214). Reactions were stopped using 1N phosphoric acid ...
-
bioRxiv - Systems Biology 2022Quote: ... using Fixation/Permeabilization Kit (554714, BD Biosciences). The stained cells were filtered through a 35 µm cell strainer snap cap and collected in a 5 ml FACS tube (Corning) ...
-
bioRxiv - Immunology 2022Quote: ... Targeted mRNA and AbSeq Amplification Kit (BD), and Immune Response Panel Mm (BD ...
-
bioRxiv - Cancer Biology 2019Quote: Annexin/Propidium Iodide staining kit from BD Pharmingen ...
-
bioRxiv - Immunology 2020Quote: ... Cytofix/CytopermTM reagent kit (BD Biosciences, 554714) was used for cell fixation and permeabilization before intracellular staining ...
-
bioRxiv - Immunology 2021Quote: ... Cytofix/Cytoperm reagent kit (BD Biosciences, 554714) was used for intracellular cytokine staining assay ...
-
bioRxiv - Neuroscience 2020Quote: ... Human Soluble Protein buffer kit (BD Biosciences) was used in conjunction with flex sets for detecting granulocyte-macrophage colony-stimulating factor (GM-CSF) ...
-
bioRxiv - Immunology 2022Quote: ... using BD Fixation/Permeabilization kit (BD Bioscience). Mice adoptively transferred with either P14WT or P14Stat5iKO were injected I.P with 2mg of BrdU at d7p.i ...
-
bioRxiv - Systems Biology 2022Quote: ... FITC BrdU flow kit (559619, BD Biosciences).
-
bioRxiv - Microbiology 2022Quote: ... using BD fixation/permeabilization kit (BD Biosciences) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... permeabilized in Cytofix/Cytoperm kit (BD Bioscience), washed twice with PermWash 1X buffer and incubated with a mixture of BV421-anti-IL-2 (clone JES6-5H4) ...
-
bioRxiv - Cancer Biology 2023Quote: ... c-Kit PE-CF594 2B8 (BD Biosciences) (1:100) ...
-
bioRxiv - Physiology 2023Quote: ... a BD Cytofix/Cytoperm kit (BD Bioscience) was employed to fix and permeabilize cells before staining them with intracellular fluorophore-conjugated antibodies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cytofix/Cytoperm solution kit (BD Biosciences, #554714) was used to the detect intracellular cytokines GZMB ...
-
A Phytochrome B-PIF4-MYC2 Module Tunes Secondary Cell Wall Thickening in Response to Shaded LightingbioRxiv - Plant Biology 2021Quote: The coding sequence of MYC2 PCR-amplified from cDNA using PHANTA was fused with GAL4 DNA-binding domain (BD) of the bait vector pGBKT7 (Clontech) ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmid transduction into the above-mentioned yeast strains was confirmed by PCR (KK70/CY179 for AGB1.x-BD, KK281/CY180 for AGG1-AD ...
-
bioRxiv - Cell Biology 2020Quote: ... ELISA kits were used to quantify secreted TNF (Ready-SET-Go! Mouse TNFα Kit, eBiosciences,88732488) and IL-6 (BD OptiEIA ...
-
bioRxiv - Cancer Biology 2024Quote: ... obtained from Merck was utilized in the in-vitro cytotoxicity experiment. The Annexin V/ PI Kit (#Cat. No: 556547) and JC-1 Kit (#Cat. No: 551302) were procured from BD Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... The coding sequence for the target protein was PCR amplified from pDONR223-CenpC40 (forward primer: CAGATCTCGAGTGGCTGCGTCCGGTCTGGA, reverse primer: TCCGGTGGATCCTTAGCATTTCAGGCAACTCTCCT) and inserted into pEGFP-Tub (BD Biosciences Clontech ...
-
bioRxiv - Neuroscience 2020Quote: ... the isolated cells with fluorescence signals were sorted and enriched directly into 0.2-μl PCR tubes by a FACS machine (BD Influx). Noted that ...
-
bioRxiv - Plant Biology 2022Quote: ... and the PCR products were fused into the activation domain (AD) vector pGADT7 and/or the DNA-binding domain (BD) vector pGBKT7 and verified by sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... The BD Pharmingen BrdU Flow Kit from BD Biosciences was used to detect intracellular BrdU in T cells according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: APC BrdU Flow Kit (cat# 552598, BD Bioscience)
-
bioRxiv - Immunology 2021Quote: ... using the Fixation/Permeabilization Solution kit from BD Biosciences (San Jose ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA Damage and Cell Proliferation Kit (BD Pharmingen), following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... Enzyme-Linked Immunosorbent Assays (ELISAs) kits (BD Biosciences) for Interleukin-6 (IL-6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-c-kit (APC, clone 2B8, BD Pharmingen), anti-Sca-1 (PerCP-Cy5.5 ...
-
bioRxiv - Immunology 2021Quote: ... The Fixation/Permeabilization Solution Kit (BD Biosciences, 554714) was used for exposing cytoplasmic antigens ...