Labshake search
Citations for Becton, Dickinson and Company :
701 - 750 of 5827 citations for Mouse Angiotensin III Ang III CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and the cells were subjected to analysis and sorting using a FACSAria III flow cytometer (BD Biosciences, USA). HEp-2 cells infected with RSV-A2-mKate at an MOI of 4 and naïve DIO-stained cells were used for compensation ...
-
bioRxiv - Immunology 2022Quote: ... and CD8+ CD44high T cells from dLN were sorted using FACS Aria II or Aria III (BD Biosciences). Nonviable cells were excluded from the analysis based on forward and side scatter profiles and propidium iodide staining ...
-
bioRxiv - Cell Biology 2022Quote: ... and subsequent isolation of single Hyper2-fluorescent clones by cell sorting on a BD FACSAria III (BD Biosciences). All cell lines used in this study including parental cell lines ...
-
bioRxiv - Microbiology 2021Quote: Samples were analyzed by using a BD FACS Aria™ III flow cytometer (BD Biosciences, San Jose, CA). The cytometer was set up using an 85 μm nozzle and was calibrated daily using BD FACSDiva Cytometer Setup and Tracking (CS&T ...
-
bioRxiv - Immunology 2020Quote: ... Stained cells were analyzed on a LSR Fortessa flow cytometry or sorted using a FACSAria III (BD Biosciences). Data were analyzed with FlowJo software (Treestar).
-
bioRxiv - Cancer Biology 2021Quote: ... GFP-expressing PC-3 cells were sorted by FACS Aria III (BD Life Sciences, Franklin Lakes, NJ, USA) and maintained with complete medium ...
-
bioRxiv - Immunology 2022Quote: ... Cells were counterstained with DAPI to exclude dead cells and sorted using an Aria III cell sorter (BD) into skirted 96-well plates for scRNAseq ...
-
bioRxiv - Immunology 2022Quote: ... Stained samples were washed in sort medium and bulk-sorted on an Aria III cell sorter (BD Biosciences) (see Fig S6B for a gating example) ...
-
bioRxiv - Biophysics 2022Quote: ... and the EGFP-positive cells were isolated using flow cytometry (BD FACS Aria III™, BD Biosciences, USA). The single isolated cells were expanded and used for the experiments ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the lower expressing population was isolated by fluorescence-activated cell sorting on a BD Aria III (BD Biosciences ...
-
bioRxiv - Developmental Biology 2020Quote: ... the enrichment of pachytene spermatocytes and round spermatids was performed on a FACSAria III cell sorter from BD Biosciences ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and tdT-positive cells were sorted using a FACSAria III fluorescence-activated cell sorter (BD Biosciences, CA, USA).
-
bioRxiv - Immunology 2020Quote: ... and the CD4+ fraction was then sorted as CD4+ CD25- CD62L+ CD44- by FACS ARIA III (BD Biosciences).
-
bioRxiv - Developmental Biology 2019Quote: ... and passed through a 35 μm filter before sorting using a BD FACSAria III Cell Sorter (BD Biosciences). Gating was performed to isolate intact cells from debris and to isolate positive fluorescent glial or progenitor cells ...
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (1:1000) was added after primary antibody incubation and before FANS (FACSAria™ III sorter; BD Biosciences). Nuclei were collected in Trizol LS (Life Technologies ...
-
bioRxiv - Genomics 2020Quote: ... Ninety-five NeuN+ single nuclei were sorted into a 96-well plate by FACS (BD FACSAria™ III). Whole genome amplification was performed by multiple displacement amplification (MDA ...
-
bioRxiv - Genomics 2021Quote: ... The samples were filtered through a 70 μm cell strainer and sorted on a FACSAria III (BD Biosciences) using a 100 μm nozzle ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fluorescence-activated cell sorting (FACS) was conducted using a FACS Aria III and FACS SORP Aria (BD Biosciences).
-
bioRxiv - Cancer Biology 2022Quote: ... Cell sorting for GFP+CD19+CD45+CD11b- cells was performed using FACSAria™ III cell sorter (BD Biosciences) on day 7 ...
-
bioRxiv - Biophysics 2022Quote: ... and the EGFP-positive cells were isolated using flow cytometry (BD FACS Aria III™, BD Biosciences, USA). The single isolated cells were expanded and used for the experiments ...
-
bioRxiv - Immunology 2023Quote: ... Monocytes were sorted into HBSS-2% FCS in 15ml Falcon tubes using a BD Aria III (BD Biosciences). Monocytes were gated as Lineage-negative (B220 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were sorted to 384well lysis plates using a FACSAria-III or Symphony S6 flow cytometer (BD Biosciences), excluding doublets and cell debris by FSC and SSC metrics.
-
bioRxiv - Developmental Biology 2023Quote: ... 1×107 cells\ml were passed to FACS tubes and sorted using ARIA III FACS (BD Biosciences, USA) into 1 ml autoMACS® Running Buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell sorting was performed using a FACS Aria III cell sorter supported by the FACSDiva software (BD Biosciences). Cells were selected by forward scatter ...
-
bioRxiv - Neuroscience 2023Quote: ... We sorted tdTomato-positive/DAPI- negative cells into 4 96-well plates using an ARIA Sorter III (BD) and BD FACSDiva software 8.0.1.
-
bioRxiv - Cancer Biology 2023Quote: ... was added immediately before the cell sorting procedure using a FACS Aria III cytometer (Becton, Dickinson and Company). The gating strategy is described in Supplementary Figure 1A.
-
bioRxiv - Cell Biology 2023Quote: ... was added immediately before analysis or sorting using a FACS Aria III with FACS DiVA software (BD Biosciences).
-
bioRxiv - Cancer Biology 2023Quote: ... single cells were deposited in 96 well plates using a BD FACSAria III (BD Biosciences, Franklin Lakes, NJ). Outgrowing clones were condensed to a 96 well plate in duplicate to propagate clones and generate a genomic DNA source ...
-
bioRxiv - Cell Biology 2023Quote: ... single cells were deposited in 96-well plates by flow sorting with a FACS Aria III (BD Biosciences). Single clones were expanded and DNAs were prepared from 81 clones ...
-
bioRxiv - Cell Biology 2023Quote: Fluorescence activated cell sorting was performed on an Aria III cell sorter using FACSDiva version 8.0.1 (BD Biosciences). The gating of live cells was carried out based on the front and side scatter signal ...
-
bioRxiv - Immunology 2023Quote: ... Live CD11b−F4/80−B220−CD90.2+CD4+CD44hi CD4 T cells were sorted using FACSAria III (BD Biosciences), partitioned using a Chromium Controller (10x Genomics) ...
-
bioRxiv - Cell Biology 2023Quote: ... Monoclonal organoids were produced by isolating and sorting positive miRFP cells using a FACS-ARIA III (BD Biosciences) after two rounds of passages.
-
bioRxiv - Microbiology 2023Quote: ... single cells were sorted using fluorescence-activated cell sorting (FACS) with BD FACSAria III Cell Sorter (BD Biosciences). Cells were gated based on their optical properties (chlorophyll autofluorescence ∼5×104 A.U. ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells are carefully resuspended in 0.8X PBS and flow sorted with a FACSAria III (BD Biosciences, Franklin Lakes) using an 85 μm nozzle into 200 μL of RLT buffer (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... The EV uptake was analyzed on the FITC channel using the BD FACS Aria III cytometer (BD Biosciences). For DC maturation assays ...
-
bioRxiv - Microbiology 2024Quote: ... Neutrophils containing ingested labeled conidia were sorted using the BD FACSAria™ III (BD Biosciences, San Jose, CA). BAL Lactate dehydrogenase (LDH ...
-
bioRxiv - Neuroscience 2024Quote: ... The fluorescence intensity of the filtered samples was measured using a FACS Aria III cell sorter (BD Biosciences). Flow cytometry was performed on EV- or AAV-treated HEK293-EGFP cells for comparing the genome-editing efficiency of sgRNA (#1-#4 ...
-
PD-1 checkpoint blockade disrupts CD4 T cell regulated adaptive B cell tolerance to foreign antigensbioRxiv - Immunology 2021Quote: All flow cytometry sample data was collected using a BD FACSAria III on a workstation running FACSDiva software version 8.0.1 (BD Biosciences). Cytometry data analysis was performed using FlowJo version 10 (TreeStar) ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Cell Biology 2020Quote: ... Flow cytometry was performed using a Fortesa flow cytometer and FACSAria III sorter (BD Immunocytometry Systems, San Jose, CA) and analyzed using Flow Jo 9.9.6 software (Tree Star ...
-
bioRxiv - Immunology 2021Quote: Flow cytometry analysis and single cell sorting was done using a 4-laser 20-parameter BD FACSAria III with FACSDiva v8.0.1 software (BD Biosciences). Single cells were sorted into 384- well plates while index sorting software (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Immunology 2021Quote: ... On the next day CD4+ cells were stained and naïve (CD4+CD127highCD25-CD45RO-) or memory (CD4+CD127highCD25-CD45RO+) cells were sorted using FACSAria III (BD). Isolated CD4+ cells were seeded at density of 2×106 cells/ml in AIMV medium containing 10% FCS and 1% Pen/Strep and cultured for at least 24 h before conducting experiments ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Immunology 2019Quote: 500 cells per population were sorted into lysis buffer using a BD FACSARIA III or FACSFUSION instruments (BD Biosciences), and cDNA was prepared using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cells were sorted by level of GFP expression into five bins using Aria III flow cytometer (BD Biosciences) with median GFP fluorescence of 20 ...
-
bioRxiv - Cell Biology 2019Quote: Asynchronous NDB cells showing the lowest 10% forward scatter width (FSC-W) signal were isolated by FACSAria III (BD). This sorting protocol yields a nearly pure G1 population without pre-synchronization (Vecsler ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were sorted and cloned in 96-well culture plates using the BD FACSAria III (BD Biosciences). The isolated clones were screened by immunoblot and the mutations validated using the Surveyor® assay (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... Fluorescence-activated cell sorting (FACS) was performed using a BD FACSARIATM III sorter and the software FACSDiva v 8.0.1 (both BD Bioscience). Data was analyzed using FlowJo v 10 (Tree Star ...
-
bioRxiv - Plant Biology 2021Quote: ... The protoplasts were resuspended in the 8% mannitol and sorted with the cytometry (BD bioscience, ARIA III Cell sorter) with the GFP signal and single-cell pattern to isolate the high purity (~ 100% ...