Labshake search
Citations for Becton, Dickinson and Company :
751 - 800 of 6174 citations for Mouse Angiotensin III Ang III CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... The samples were filtered through a 70 μm cell strainer and sorted on a FACSAria III (BD Biosciences) using a 100 μm nozzle ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fluorescence-activated cell sorting (FACS) was conducted using a FACS Aria III and FACS SORP Aria (BD Biosciences).
-
bioRxiv - Cancer Biology 2022Quote: ... Cell sorting for GFP+CD19+CD45+CD11b- cells was performed using FACSAria™ III cell sorter (BD Biosciences) on day 7 ...
-
bioRxiv - Biophysics 2022Quote: ... and the EGFP-positive cells were isolated using flow cytometry (BD FACS Aria III™, BD Biosciences, USA). The single isolated cells were expanded and used for the experiments ...
-
bioRxiv - Microbiology 2023Quote: ... The EV uptake was analyzed on the FITC channel using the BD FACS Aria III cytometer (BD Biosciences). For DC maturation assays ...
-
bioRxiv - Microbiology 2024Quote: ... Neutrophils containing ingested labeled conidia were sorted using the BD FACSAria™ III (BD Biosciences, San Jose, CA). BAL Lactate dehydrogenase (LDH ...
-
bioRxiv - Neuroscience 2024Quote: ... The fluorescence intensity of the filtered samples was measured using a FACS Aria III cell sorter (BD Biosciences). Flow cytometry was performed on EV- or AAV-treated HEK293-EGFP cells for comparing the genome-editing efficiency of sgRNA (#1-#4 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells are carefully resuspended in 0.8X PBS and flow sorted with a FACSAria III (BD Biosciences, Franklin Lakes) using an 85 μm nozzle into 200 μL of RLT buffer (Qiagen ...
-
bioRxiv - Immunology 2023Quote: ... Monocytes were sorted into HBSS-2% FCS in 15ml Falcon tubes using a BD Aria III (BD Biosciences). Monocytes were gated as Lineage-negative (B220 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were sorted to 384well lysis plates using a FACSAria-III or Symphony S6 flow cytometer (BD Biosciences), excluding doublets and cell debris by FSC and SSC metrics.
-
bioRxiv - Developmental Biology 2023Quote: ... 1×107 cells\ml were passed to FACS tubes and sorted using ARIA III FACS (BD Biosciences, USA) into 1 ml autoMACS® Running Buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell sorting was performed using a FACS Aria III cell sorter supported by the FACSDiva software (BD Biosciences). Cells were selected by forward scatter ...
-
bioRxiv - Neuroscience 2023Quote: ... We sorted tdTomato-positive/DAPI- negative cells into 4 96-well plates using an ARIA Sorter III (BD) and BD FACSDiva software 8.0.1.
-
bioRxiv - Cancer Biology 2023Quote: ... was added immediately before the cell sorting procedure using a FACS Aria III cytometer (Becton, Dickinson and Company). The gating strategy is described in Supplementary Figure 1A.
-
bioRxiv - Cell Biology 2023Quote: ... was added immediately before analysis or sorting using a FACS Aria III with FACS DiVA software (BD Biosciences).
-
bioRxiv - Cancer Biology 2023Quote: ... single cells were deposited in 96 well plates using a BD FACSAria III (BD Biosciences, Franklin Lakes, NJ). Outgrowing clones were condensed to a 96 well plate in duplicate to propagate clones and generate a genomic DNA source ...
-
bioRxiv - Cell Biology 2023Quote: ... single cells were deposited in 96-well plates by flow sorting with a FACS Aria III (BD Biosciences). Single clones were expanded and DNAs were prepared from 81 clones ...
-
bioRxiv - Cell Biology 2023Quote: Fluorescence activated cell sorting was performed on an Aria III cell sorter using FACSDiva version 8.0.1 (BD Biosciences). The gating of live cells was carried out based on the front and side scatter signal ...
-
bioRxiv - Immunology 2023Quote: ... Live CD11b−F4/80−B220−CD90.2+CD4+CD44hi CD4 T cells were sorted using FACSAria III (BD Biosciences), partitioned using a Chromium Controller (10x Genomics) ...
-
bioRxiv - Cell Biology 2023Quote: ... Monoclonal organoids were produced by isolating and sorting positive miRFP cells using a FACS-ARIA III (BD Biosciences) after two rounds of passages.
-
bioRxiv - Microbiology 2023Quote: ... single cells were sorted using fluorescence-activated cell sorting (FACS) with BD FACSAria III Cell Sorter (BD Biosciences). Cells were gated based on their optical properties (chlorophyll autofluorescence ∼5×104 A.U. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were washed and resuspended in FWB and analyzed using a FACS Aria II or III instrument (BD). Data were analyzed using FlowJo software version 10.8.1.
-
bioRxiv - Evolutionary Biology 2024Quote: Bacterial cells were dispensed in M9 buffer prior to analysis using a flow cytometer (BD, USA, FACSAria III). Fluorescence intensity from GFP (GFP FI ...
-
bioRxiv - Developmental Biology 2024Quote: ... and filtered through a 40-um nylon mesh for sorting with a BD FACS Aria III (BD Biosciences) with assistance from the University of Washington Pathology Flow Cytometry Core Facility ...
-
bioRxiv - Pathology 2024Quote: ... The cells were washed with PBS and analyzed using a FACSAria III cell sorter (BD/Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... GFP-expressing cells were then isolated by fluorescence-activated cell sorting (FACS) on a FACSAria III machine (BD Biosciences ...
-
PD-1 checkpoint blockade disrupts CD4 T cell regulated adaptive B cell tolerance to foreign antigensbioRxiv - Immunology 2021Quote: All flow cytometry sample data was collected using a BD FACSAria III on a workstation running FACSDiva software version 8.0.1 (BD Biosciences). Cytometry data analysis was performed using FlowJo version 10 (TreeStar) ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Cell Biology 2020Quote: ... Flow cytometry was performed using a Fortesa flow cytometer and FACSAria III sorter (BD Immunocytometry Systems, San Jose, CA) and analyzed using Flow Jo 9.9.6 software (Tree Star ...
-
bioRxiv - Immunology 2021Quote: Flow cytometry analysis and single cell sorting was done using a 4-laser 20-parameter BD FACSAria III with FACSDiva v8.0.1 software (BD Biosciences). Single cells were sorted into 384- well plates while index sorting software (BD Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... cells were selectively sorted into 96 well plates using a FACS Aria III with FACS Diva software (BD Biosciences). Plates were incubated at 37°C for a minimum of 14 hours ...
-
bioRxiv - Immunology 2021Quote: ... On the next day CD4+ cells were stained and naïve (CD4+CD127highCD25-CD45RO-) or memory (CD4+CD127highCD25-CD45RO+) cells were sorted using FACSAria III (BD). Isolated CD4+ cells were seeded at density of 2×106 cells/ml in AIMV medium containing 10% FCS and 1% Pen/Strep and cultured for at least 24 h before conducting experiments ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... after which cells were single cell sorted into 96-well plates coated with 0.1% gelatin with an BD FACS AriaTM III Cell Sorted (BD). For ICAM-2 knockout and for the ICAM-1/2 double knockout ...
-
bioRxiv - Immunology 2019Quote: 500 cells per population were sorted into lysis buffer using a BD FACSARIA III or FACSFUSION instruments (BD Biosciences), and cDNA was prepared using the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (Takara) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cells were sorted by level of GFP expression into five bins using Aria III flow cytometer (BD Biosciences) with median GFP fluorescence of 20 ...
-
bioRxiv - Cell Biology 2019Quote: Asynchronous NDB cells showing the lowest 10% forward scatter width (FSC-W) signal were isolated by FACSAria III (BD). This sorting protocol yields a nearly pure G1 population without pre-synchronization (Vecsler ...
-
bioRxiv - Cancer Biology 2020Quote: ... GFP positive cells were sorted and cloned in 96-well culture plates using the BD FACSAria III (BD Biosciences). The isolated clones were screened by immunoblot and the mutations validated using the Surveyor® assay (Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... Fluorescence-activated cell sorting (FACS) was performed using a BD FACSARIATM III sorter and the software FACSDiva v 8.0.1 (both BD Bioscience). Data was analyzed using FlowJo v 10 (Tree Star ...
-
bioRxiv - Plant Biology 2021Quote: ... The protoplasts were resuspended in the 8% mannitol and sorted with the cytometry (BD bioscience, ARIA III Cell sorter) with the GFP signal and single-cell pattern to isolate the high purity (~ 100% ...
-
bioRxiv - Microbiology 2021Quote: ... Viable NHDF and NHEK were sorted based on their negative DAPI signal with a FACSAria III cytometer (BD Biosciences) and collected in a single tube ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were sorted at a concentration of 2 million cells per mL using FACS- Aria-III (BD Biosciences). Forward and side scatter parameters were adjusted so as to eliminate cell clumps and debris ...
-
bioRxiv - Immunology 2022Quote: ... PDPN (NZ-1.3) and Ghost Dye Violet 510 (Tonbo) for fluorescence activated cell sorting (BD FACSAria III Cell Sorter). Synovial fibroblasts (CD45- ...
-
bioRxiv - Cell Biology 2022Quote: ... filtered through a 40 μm filter and subjected to sorting procedure on a FACS Aria III Cell Sorter (BD) and subjected to live flow cytometry analysis procedure on a Cytoflex S (Beckman-Coulter) ...
-
bioRxiv - Physiology 2020Quote: ... and CD44+/CD24− cells were analyzed by using a FACSAria III flow cytometer (BD Biosciences, San Jose, CA, USA).
-
bioRxiv - Cell Biology 2022Quote: ... or FlowJo software (FlowJo, LLC) and cell sorting was performed using a FACS Aria III Cell Sorter (BD Biosciences).
-
bioRxiv - Systems Biology 2022Quote: ... a GFP high population was harvested by FACS for further experiments using a BD FACSAria III machine (BD Biosciences).
-
bioRxiv - Immunology 2022Quote: ... and analysed using FlowJo version 10.1 software (Tree Star, Ashland, OR) or sorted on an FACSAria III (BD Biosciences).
-
bioRxiv - Cancer Biology 2019Quote: ... Cell sorting was performed using a BD FACS Aria III cell-sorting system (BD Biosciences, San Jose, CA, USA). Cells were sorted directly into Hank’s Balanced Salt solution (catalog number 14175-095 ...
-
bioRxiv - Systems Biology 2020Quote: ... Triple positive live cells (GFP+ Pdpn+ CD31+) (LECs) were gated and sorted on a BD FACSAria III (BD Biosciences) (100 um nozzle ...
-
bioRxiv - Immunology 2019Quote: ... CEM cells were selected by fluorescence-activated cell sorting based on GFP expression using FACS Aria III (BD Bioscience). Eight days later ...