Labshake search
Citations for Becton, Dickinson and Company :
501 - 550 of 5097 citations for Lysophosphatidic Acid Receptor 5 LPAR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: Cells were grown overnight at 30°C in SC medium (0.67% nitrogen base without amino acids (BD), 2% dextrose supplemented with amino acids mixture (AA mixture ...
-
Re-investigating the coughing rat model of pertussis to understand Bordetella pertussis pathogenesisbioRxiv - Immunology 2021Quote: ... Upon euthanasia blood was collected via cardiac puncture and transferred into ethylenediaminetetraacetic acid (EDTA) (BD Cat. 365974) and serum separation (BD Cat ...
-
bioRxiv - Synthetic Biology 2022Quote: ... CSM-URA was made with Yeast Nitrogen Base (YNB) without amino acids 0.67% w/v (BD 291940), D-glucose 2% w/v ...
-
bioRxiv - Physiology 2022Quote: ... 0.1 nM retinoic acid) supplemented with 1x penicillin/streptomycin and 2% NuSerum (BD Biosciences, San Jose, CA) as described (39) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthetic dextrose minimal medium (SD) contains 6.3 g/L Yeast Nitrogen Base w/o Amino Acids (BD), 2% glucose and 0.1 mg/mL each of required amino acids ...
-
bioRxiv - Microbiology 2024Quote: ... Germany] added to M9 medium) supplemented with 0.3% (w/v) casamino acids (BD, Franklin Lakes, NJ, USA) in sterile 15 mL tubes (Sarstedt ...
-
bioRxiv - Microbiology 2023Quote: ... followed by subculture in yeast nitrogen base (YNB) medium with amino acids (BD Difco, Franklin Lakes, NJ) supplemented with 0.05% dextrose overnight ...
-
bioRxiv - Microbiology 2022Quote: ... A synthetic defined medium (SD-medium) (yeast nitrogen base without amino acids containing 0.17% ammonium sulfate [BD Difco] ...
-
bioRxiv - Cell Biology 2023Quote: ... The SC medium contained 0.67% yeast nitrogen base without amino acids (Becton, Dickinson and Company, MD, USA), 2% D-glucose ...
-
bioRxiv - Pathology 2024Quote: Peripheral venous blood from patients was collected into ethylenediaminetetraacetic acid (EDTA) anti-coagulated tubes (BD Vacutainer, UK). 400 μl blood was added to 10 ml of 1x lysis solution (BD Pharm Lyse ...
-
bioRxiv - Cancer Biology 2023Quote: ... Blood was collected at the time of surgery into vacuum tubes containing ethylenediaminetetraacetic acid (EDTA) (BD Bioscience). Cells were isolated by ficoll-density centrifugation and frozen in fetal bovine serum with 5% dimethyl sulfoxide ...
-
bioRxiv - Bioengineering 2024Quote: ... Tryptone and yeast extract were obtained from OXOID (United Kingdom) and Casamino acids were purchased from BD Corporation (USA) ...
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Developmental Biology 2024Quote: All cell culture of all species was maintained at 37°C with 5% CO2 and 5% O2 on Matrigel (1:100, BD Corning) coated plates unless otherwise specified ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μl of this suspension (1×10e5) was transferred to a 5 ml culture tube and 5 μl of FITC Annexin V (BD Biosciences) added ...
-
bioRxiv - Biochemistry 2024Quote: ... the cell pellet was resuspended in 1 mL sterile PBS/5% FBS and transferred to a 5 mL flow cytometry tube via a 40 µm strainer cap (BD Falcon). Viability of the final samples was between 30-35% by trypan blue exclusion ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibodies used for immunoprecipitations were mouse anti-ASCL1 antibodies (BD-Biosciences 556604) and normal mouse IgG (Santa Cruz Biotechnology sc-2025) ...
-
DJ-1 (Park7) affects the gut microbiome, metabolites and development of Innate Lymphoid cells (ILCs)bioRxiv - Immunology 2019Quote: ... Antibody staining was performed using α-Synuclein antibody (# 610786 BD Biosciences, Netherlands) for overnight (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used were as follows: anti-Paxillin and anti-GM130 antibodies (BD Transduction Laboratories ...
-
bioRxiv - Developmental Biology 2022Quote: ... stained with Epcam antibody (anti-CD326 antibody, BD Biosciences, # 563214, 1/500), and sorted for Epcam- and Epcam+ cells ...
-
bioRxiv - Genetics 2023Quote: Antibodies used for immunohistochemistry were as follows: anti-CtBP2/RIBEYE antibody (BD Transduction Laboratories #612044 ...
-
bioRxiv - Biochemistry 2024Quote: ... The following antibodies were used: anti-HIF-1α mouse monoclonal antibody (BD Transduction Laboratories ...
-
bioRxiv - Cancer Biology 2019Quote: ... HIF1α antibody (610958, BD). HRP-conjugated secondary antibodies were obtained from GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: ... CD107a-PE antibody (BD) was added into each well and incubated at 37°C for 4 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... N-cadherin antibody (BD Transduction Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... p62 antibody (#BD 610832), Lamp1 antibody (#BD 555798 ...
-
bioRxiv - Cell Biology 2021Quote: ... Lamp1 antibody (#BD 555798) and CD63 antibody (#BD 556019) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Antibodies were from BD Biosciences (www.bdbiosciences.com ...
-
bioRxiv - Cell Biology 2020Quote: ... STIM1 antibody from BD Transduction Laboratories (Franklin Lakes ...
-
bioRxiv - Immunology 2020Quote: ... Antibodies are from BD Biosciences or BioXCell ...
-
bioRxiv - Cell Biology 2022Quote: ... CD24 antibody (BD Biosciences) and GtαMo AlexaFluor546 (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... (antibodies from BD Biosciences) and Rab5 (PE-CF594 ...
-
bioRxiv - Immunology 2023Quote: ... Antibody capture beads (BD) were used for single-stain compensation controls ...
-
bioRxiv - Immunology 2023Quote: ... detection antibody (IFNγ, BD Biosciences #51-1818KA ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-paxillin antibody (BD Biosciences #610052 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...
-
bioRxiv - Systems Biology 2020Quote: ... CSP consists of 1.7 g/L Yeast Nitrogen Base without Amino Acids and Ammonium Sulfate (BD Difco(tm)) ...
-
bioRxiv - Immunology 2022Quote: About 8 ml of blood was collected in acid citrate dextrose (ACD) tubes (Cat. Number 364606, BD Biosciences) for platelet isolation ...
-
bioRxiv - Physiology 2022Quote: ... 0.1 nM retinoic acid) supplemented with 1x penicillin/streptomycin and 2% NuSerum (BD Biosciences/Corning, San Jose, CA) as described.(50 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mtb was grown in Middlebrook 7H9 supplemented with 10% (v/v) oleic acid/dextrose/catalase supplement (OADC; BD), 0.2% (v/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were stained with anti-CXCR4 antibodies (APC-labeled 12G5 antibody, 555976 or PE-labeled 1D9 antibody, 551510 from BD Biosciences).
-
bioRxiv - Cancer Biology 2021Quote: ... cells were stained with anti-CXCR4 antibodies (APC-labeled 12G5 antibody, 555976 or PE-labeled 1D9 antibody, 551510 from BD Biosciences).