Labshake search
Citations for Becton, Dickinson and Company :
451 - 500 of 4827 citations for Lysophosphatidic Acid Receptor 5 LPAR5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 g/L Difco Yeast Extract (BD 210929), 1.15 g/L citric acid (Sigma-Aldrich C0759) ...
-
bioRxiv - Genomics 2022Quote: ... anti-CD11b-V450(BD Bioscience Clone: WT.5), anti-CD11a-PE (BD Bioscience Clone ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD4 BUV805 (BD Bioscience; clone: RM4-5), anti-CD8 BV421 (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD4 FITC (BD Biosciences, clone RM4-5) and anti-CD19 APC-Cy7 (BD Biosciences ...
-
bioRxiv - Systems Biology 2023Quote: ... anti–IFN-γ (5 µg/mL; BD Biosciences), and anti–IL-12 (5 µg/mL ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-APC (BD Bioscience, X54-5/7.1), Anti-F4/80-BV421 (Biolegend ...
-
bioRxiv - Immunology 2023Quote: ... Anti-CD64-AF647 (BD Pharmigen, X54-5/7.1), Anti-Siglec-F-PE (BD Pharmigen ...
-
bioRxiv - Systems Biology 2023Quote: ... anti–IL-4 (5 µg/mL; BD Biosciences); Th2 cells ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µg/ml anti-ITGB1 (BD Bioscience) in BMMC culture media at 37°C and 5% CO2 for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), and anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Immunology 2024Quote: ... anti-CD4-V500 (Clone RM4-5, BD Biosciences), anti-CD8a-PE-Cyanine5 (Clone 53-6.7 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μl of anti-CD45-APC (BD Biosciences), and 5 μl of anti-CD326 (EPCAM)-PE-Cy7 (BD Biosciences ...
-
bioRxiv - Molecular Biology 2024Quote: ... positive and CD45 (BD Biosciences, 555483, 1/5) negative MSC population (Giuliani et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was done with 5% skim milk (BD) in TBST (TBS+0.1% Tween-20) ...
-
bioRxiv - Cell Biology 2019Quote: ... The following antibodies were used: anti-E-cadherin antibody (BD Bioscience), anti-ß-tubulin antibody (Millipore) ...
-
bioRxiv - Systems Biology 2020Quote: ... BV786 Mouse Anti-Human CD38 antibodies (all antibodies from BD Biosciences) for 30 min at room temperature in the dark ...
-
bioRxiv - Genomics 2021Quote: ... Isotype-matched irrelevant mouse monoclonal antibodies or irrelevant polyclonal antibodies (BD Biosciences ...
-
bioRxiv - Genetics 2021Quote: YNB (6.7 g yeast nitrogen base with ammonium sulfate and without amino acids (BD Biosciences cat# 291940), 20 g glucose ...
-
bioRxiv - Microbiology 2020Quote: ... smegmatis strains were grown in 7H9 broth supplemented with 10% OADC (oleic acid-albumin-dextrose-catalase; BD) and 0.05% Tween 80 ...
-
bioRxiv - Microbiology 2021Quote: ... Upon euthanasia blood was collected via cardiac puncture and transferred into ethylenediaminetetraacetic acid (EDTA) (BD Cat. 365974) and serum separation (BD Cat ...
-
bioRxiv - Immunology 2022Quote: Peripheral blood was collected in a blood collection tube containing ethylenediaminetetraacetic acid [EDTA] (Becton, Dickinson and Company). Plasma was isolated by centrifugation at 2,000 × g for 20 min and stored at -80°C ...
-
bioRxiv - Microbiology 2020Quote: ... It should be noted that at a concentration of 0.1% (w/v) bacto casamino acids (BD Difco), the medium already contains ~163 μM Pi ...
-
bioRxiv - Molecular Biology 2019Quote: Cells were grown overnight at 30°C in SC medium (0.67% nitrogen base without amino acids (BD), 2% dextrose supplemented with amino acids mixture (AA mixture ...
-
Re-investigating the coughing rat model of pertussis to understand Bordetella pertussis pathogenesisbioRxiv - Immunology 2021Quote: ... Upon euthanasia blood was collected via cardiac puncture and transferred into ethylenediaminetetraacetic acid (EDTA) (BD Cat. 365974) and serum separation (BD Cat ...
-
bioRxiv - Synthetic Biology 2022Quote: ... CSM-URA was made with Yeast Nitrogen Base (YNB) without amino acids 0.67% w/v (BD 291940), D-glucose 2% w/v ...
-
bioRxiv - Physiology 2022Quote: ... 0.1 nM retinoic acid) supplemented with 1x penicillin/streptomycin and 2% NuSerum (BD Biosciences, San Jose, CA) as described (39) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Synthetic dextrose minimal medium (SD) contains 6.3 g/L Yeast Nitrogen Base w/o Amino Acids (BD), 2% glucose and 0.1 mg/mL each of required amino acids ...
-
bioRxiv - Microbiology 2023Quote: ... followed by subculture in yeast nitrogen base (YNB) medium with amino acids (BD Difco, Franklin Lakes, NJ) supplemented with 0.05% dextrose overnight ...
-
bioRxiv - Microbiology 2022Quote: ... A synthetic defined medium (SD-medium) (yeast nitrogen base without amino acids containing 0.17% ammonium sulfate [BD Difco] ...
-
bioRxiv - Cell Biology 2023Quote: ... The SC medium contained 0.67% yeast nitrogen base without amino acids (Becton, Dickinson and Company, MD, USA), 2% D-glucose ...
-
bioRxiv - Cancer Biology 2023Quote: ... Blood was collected at the time of surgery into vacuum tubes containing ethylenediaminetetraacetic acid (EDTA) (BD Bioscience). Cells were isolated by ficoll-density centrifugation and frozen in fetal bovine serum with 5% dimethyl sulfoxide ...
-
bioRxiv - Pathology 2024Quote: Peripheral venous blood from patients was collected into ethylenediaminetetraacetic acid (EDTA) anti-coagulated tubes (BD Vacutainer, UK). 400 μl blood was added to 10 ml of 1x lysis solution (BD Pharm Lyse ...
-
bioRxiv - Microbiology 2024Quote: ... Germany] added to M9 medium) supplemented with 0.3% (w/v) casamino acids (BD, Franklin Lakes, NJ, USA) in sterile 15 mL tubes (Sarstedt ...
-
bioRxiv - Cell Biology 2019Quote: ... strains were cultured in modified TYI-S-33 medium supplemented with bovine bile and 5% adult and 5% fetal bovine serum [56] in sterile 16 ml screw-capped disposable tubes (BD Falcon). Cultures were incubated upright at 37°C without shaking as previously described(Hagen et al. ...
-
bioRxiv - Immunology 2020Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 μM Bl-Eng2 or calnexin peptide and 1μg anti-mouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2021Quote: ... lung T cells were incubated at 37°C for 5 hours with 5 µM Bl-Eng2 peptide and 1µg antimouse CD28 (BD, cat 553294). After 1h ...
-
bioRxiv - Immunology 2022Quote: Splenocytes from infected mice were incubated for 5 hours at 37°C 5%CO2 in cRPMI prior intra-cytoplasmic detection of active-caspase 3 (BD Bioscience) using BD Fixation/Permeabilization kit (BD Bioscience) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μl of this suspension (1×10e5) was transferred to a 5 ml culture tube and 5 μl of FITC Annexin V (BD Biosciences) added ...
-
bioRxiv - Developmental Biology 2024Quote: All cell culture of all species was maintained at 37°C with 5% CO2 and 5% O2 on Matrigel (1:100, BD Corning) coated plates unless otherwise specified ...
-
bioRxiv - Cancer Biology 2020Quote: ... Antibodies used for immunoprecipitations were mouse anti-ASCL1 antibodies (BD-Biosciences 556604) and normal mouse IgG (Santa Cruz Biotechnology sc-2025) ...
-
DJ-1 (Park7) affects the gut microbiome, metabolites and development of Innate Lymphoid cells (ILCs)bioRxiv - Immunology 2019Quote: ... Antibody staining was performed using α-Synuclein antibody (# 610786 BD Biosciences, Netherlands) for overnight (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: Antibodies used were as follows: anti-Paxillin and anti-GM130 antibodies (BD Transduction Laboratories ...
-
bioRxiv - Developmental Biology 2022Quote: ... stained with Epcam antibody (anti-CD326 antibody, BD Biosciences, # 563214, 1/500), and sorted for Epcam- and Epcam+ cells ...
-
bioRxiv - Genetics 2023Quote: Antibodies used for immunohistochemistry were as follows: anti-CtBP2/RIBEYE antibody (BD Transduction Laboratories #612044 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The isolated plasmids were used for PCR amplification of the individual library with specific forward (AD:5’ CACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGC or BD: 5’ GATGCCGTCACAGATAGATTGGCTTCAGTGG) and reverse (Y2H term reverse ...
-
bioRxiv - Microbiology 2022Quote: ... HFK were maintained in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 µM Rho kinase inhibitor (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... HFKs were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and 10 μM Rho kinase (ROCK ...
-
bioRxiv - Microbiology 2022Quote: ... These cells were cultured in E media containing 5% FBS and 5 ng/ml of mouse epidermal growth factor (EGF, BD Biosciences; 354010) and with NIH 3T3 J2 fibroblast added as feeders ...
-
bioRxiv - Microbiology 2019Quote: ... LB agar (10 g/l of BD Bacto Tryptone, 5 g/l of BD Bacto Yeast, 5 g/l of NaCl and 20 g/l of BD Bacto Agar) was used for growth of M ...
-
bioRxiv - Immunology 2020Quote: ... up to 5×106 leukocytes were incubated with 5 μg/mL E6 peptide or 1 μg/mL α-CD3e (clone 145-2C11, BD Biosciences) in the presence of 1:1000 Golgi-plug for 5 hours ...