Labshake search
Citations for Becton, Dickinson and Company :
451 - 500 of 775 citations for Prestained SDS PAGE Standards Single Color since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and subsequent isolation of single Hyper2-fluorescent clones by cell sorting on a BD FACSAria III (BD Biosciences). All cell lines used in this study including parental cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... Single GFP positive cells were sorted into 96-well plates using the FACSAria Fusion flow cytometer (BD Biosciences). The knockout cell lines grown from the single cells were screened by western blot using an antibody against OGG1 (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... single cells were sorted in 96 well plates by flow cytometry using Influx 500 sorter-analyzer (BD BioSciences) and clonal populations then selected based on NMII isoform expression levels by immunoblot and immunofluorescence ...
-
bioRxiv - Genomics 2019Quote: ... Liquid cultures were prepared by inoculating a single colony into 10 ml of LB broth (BD, Sparks, MD), and incubated at 37 °C with agitation (180 rpm) ...
-
bioRxiv - Microbiology 2019Quote: ... A single colony of each isolate was subcultured in Bacto Brain Heart Infusion (BD Biosciences, 37 g/L) supplemented with L-cysteine-HCl (0.05% ...
-
bioRxiv - Cell Biology 2021Quote: ... we sorted single clone GFP positive cells into 96-well U-bottom plate by flow cytometry (BD Aria). It takes ∼3 weeks for cell re-population ...
-
bioRxiv - Genomics 2020Quote: ... Ninety-five NeuN+ single nuclei were sorted into a 96-well plate by FACS (BD FACSAria™ III). Whole genome amplification was performed by multiple displacement amplification (MDA ...
-
bioRxiv - Molecular Biology 2021Quote: ... the single cell suspensions were prepared with FVS510 viability stain (#564406; Becton, Dickinson and Company, New Jersey, USA) and CD16/CD32 Monoclonal Antibody (#16-0161-85 ...
-
bioRxiv - Immunology 2021Quote: ... Single cell suspensions of mouse livers were filtered through a 100μm cell strainer (BD Falcon, Franklin Lakes, NJ). Dead cells ...
-
bioRxiv - Cell Biology 2021Quote: ... CFSE fluorescence intensity was recorded for 10,000 single-cell events using a BDAccuri C6 flow cytometer (BD Biosciences). The mean of fluorescence intensity (MFI ...
-
bioRxiv - Cancer Biology 2022Quote: ... Single cell suspensions from tumor digests were prepared by passing tissue through 40-mm nylon strainers (BD Biosciences). Single cell suspensions from individual tumors were then labeled with hashtag oligonucleotides following the manufacturer’s protocol (TotalSeq B0301-B0306 ...
-
bioRxiv - Cell Biology 2022Quote: ... A single colony containing the fluorescently-labeled pCherry3 vector was inoculated into 10 ml 7H9/ADC (BD Biosciences) / 0.05 % Tween 80 (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... cells were pooled and immediately used for single-cell capture using the BD Rhapsody Express system (BD Biosciences). Directly following cell capture ...
-
bioRxiv - Immunology 2022Quote: ... Single-cell suspensions recovered from femurs and tibias were filtered through a cell strainer (70 µm; BD biosciences) and depleted in mouse cells using the Mouse Cell Depletion Kit (Miltenyi ...
-
bioRxiv - Systems Biology 2023Quote: ... and anti-CD25+ (PE) or received a single staining with anti-CD19+ (PE) labeled antibodies (BD Biosciences, Belgium). Percentages of labeled cells were determined by an LSR Fortessa flow cytometer (BD Biosciences ...
-
bioRxiv - Microbiology 2022Quote: ... Single cell suspensions stained in PBS + 2% FBS in the presence of Fc receptor blocking antibody (BD Pharmingen) and stained with the antibodies against the following mouse proteins ...
-
bioRxiv - Immunology 2023Quote: ... antibody mix 3 (Supplementary Table S4) with Sample Tag oligonucleotide-conjugated antibodies (Single-Cell Multiplexing Kit, BD Biosciences) was added to the cell suspension and left on ice for 15 minutes for staining ...
-
bioRxiv - Immunology 2023Quote: Spleens were dispersed into single-cell suspensions by mashing through a 100-μm nylon cell strainer (BD Falcon). Red blood cells were lysed with a hypotonic ammonium-chloride-potassium buffer.
-
bioRxiv - Cancer Biology 2023Quote: ... the population was single-cell FACS-sorted into 96-well plates containing RPMI11+2S (BD FACSMelody Cell Sorter). After 1.5-2 weeks ...
-
bioRxiv - Cell Biology 2023Quote: ... FSC-H vs FSC-A (for single cells) and the use of Fixable Viability Stain 700 (BD Biosciences). We used FMO controls for each experiment to determine the positive percentage expression of different surface markers ...
-
bioRxiv - Cancer Biology 2022Quote: ... Single cell clones of MMS22L-KO and CHEK2-KO were generated using BD FACSAria cell sorter (BD Biosciences) and followed by expansion.
-
bioRxiv - Cancer Biology 2023Quote: ... single cells were deposited in 96 well plates using a BD FACSAria III (BD Biosciences, Franklin Lakes, NJ). Outgrowing clones were condensed to a 96 well plate in duplicate to propagate clones and generate a genomic DNA source ...
-
bioRxiv - Cell Biology 2023Quote: ... single cells were deposited in 96-well plates by flow sorting with a FACS Aria III (BD Biosciences). Single clones were expanded and DNAs were prepared from 81 clones ...
-
bioRxiv - Cancer Biology 2023Quote: ... At 48h ATTO550+ve single cells were FACS sorted into 96-well plates (BD FACSAria Fusion cell sorter) and ...
-
bioRxiv - Microbiology 2023Quote: ... Single stained controls for compensation were done using anti-rat and anti-hamster Igκ/negative control beads (BD). Cell staining was analyzed using LSRFortessa X-20 cell analyzer (BD ...
-
bioRxiv - Bioengineering 2023Quote: ... coli strains used in the single- and multi-input gate were cultured in LB Medium (Miller) (BD Biosciences) supplemented with 100 μg/mL Carbenicillin ...
-
bioRxiv - Microbiology 2023Quote: ... single cells were sorted using fluorescence-activated cell sorting (FACS) with BD FACSAria III Cell Sorter (BD Biosciences). Cells were gated based on their optical properties (chlorophyll autofluorescence ∼5×104 A.U. ...
-
bioRxiv - Cell Biology 2023Quote: FC analyses of SkM single cell suspensions were performed with the cell analyser LSRFortessa X-20 (BD Bioscience) using the FACSDiva 8.0 software ...
-
bioRxiv - Immunology 2023Quote: ... Note these experiments were carried out using early access kits from BD Genomics before the implementation of commercially-available single-cell protein/RNA assays (e.g. Feature Barcoding, 10x Genomics; BD Abseq ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells expressing HaloTag were subjected to single-cell sorting into 96-well plates (FACSAria Fusion, BD Biosciences).
-
bioRxiv - Immunology 2024Quote: The indicated phagocyte subpopulations were sorted from single-cell lung suspensions on a FACSAria Fusion (BD Bioscience US) reaching a post-sort purity of > 97% viable phagocytes.
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were selected as single clones using FACS (Supplementary Figure S7 A) performed on the BDInflux (BD Biosciences) at the CRG/UPF Flow Cytometry Unit.
-
bioRxiv - Genomics 2024Quote: ... single cell suspensions were incubated with anti-human antibodies for EpCAM (Clone 30-F11, BD Bioscience, Cat# 561868) and CD45 (Clone HI30 ...
-
bioRxiv - Plant Biology 2019Quote: ... Yeast transformation reactions were selected on plates containing SD minimal media (BD Biosciences, San Jose, CA) supplemented with-uracil (U)/-tryptophan (W)/-histidine (H ...
-
bioRxiv - Pathology 2021Quote: ... Blood was obtained by facial vein stick and collected in a standard red top serum tube microtainer (BD Microtainer Red Tubes No Additive ...
-
bioRxiv - Immunology 2023Quote: ... Staining was accomplished with standard protocols using the following antibodies: rat anti-CD31/PECAM1 (1:100 / BD Biosciences); mouse anti-Iba1 (1:200 / wako) ...
-
bioRxiv - Immunology 2023Quote: ... The mean GFP fluorescence and standard deviation for each condition was determined in FlowJo (version 10.7, BD Biosciences) and an unpaired t-test was performed in GraphPad Prism (version 6.00 ...
-
bioRxiv - Bioengineering 2023Quote: ... all consumables used in the process were fitted with tubing extensions containing standard needle free connectors (Texium, BD). These extensions were pre-sterilized using electron beam radiation (Nutek ...
-
bioRxiv - Immunology 2021Quote: ... Single-cell suspensions were incubated for 20 min at 4°C with anti–mouse FcγRIII/II (2.4G2; BD Pharmingen) prior to staining for 1 h at 4°C with the following antibodies from BioLegend (most ...
-
bioRxiv - Cell Biology 2020Quote: ... Single clones were obtained by sorting into 96-well plates on a BD FACS Aria III machine (BD Biosciences) and homozygous tagging was confirmed by PCR using the forward primer ATCGTGGGAACGTGCTTTGGA and reverse primer GCTCAGCCTCAATAGGTACCAACA ...
-
bioRxiv - Immunology 2021Quote: Single cell suspensions from the spleen were prepared by pressing the organ through 70μm pore size strainers (BD Biosciences) in PBS 2% FCS ...
-
bioRxiv - Developmental Biology 2020Quote: ... single cell suspension of electroporated iPS cells was plated on Matrigel-coated 6 well plates (WP) (BD Bioscience #351146). Once cultures were adherent and recovered to ∼80% confluency ...
-
bioRxiv - Developmental Biology 2021Quote: ... cells were dissociated into single cell suspensions and analyzed for GFP gene expression using a FACS Fortessa (BD Biosciences). DAPI was added to detect cells with compromised membrane integrity ...
-
bioRxiv - Developmental Biology 2021Quote: ... the cells were passed through a 40um cell strainer to obtain a single cell suspension (BD Falcon, catalog# 352235).
-
bioRxiv - Immunology 2022Quote: ... surface and intracellular staining was performed on the single-cell suspensions and analyzed using LSR Fortessa cell analyzer (BD). The joints were also processed and stained similarly with atibodoies listed in Table S2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... populations of knockout (or control) cells were FACS sorted as single cells in 96-well plates (BD FACSAria II) and allowed to grow for approximately 2 weeks ...
-
bioRxiv - Genetics 2020Quote: ... single cells were sorted into 96 well plates containing 200μl of media using a FACSMelody cell sorter (BD Biosciences); the plates were monitored biweekly by imaging (Cell Metric ...
-
bioRxiv - Developmental Biology 2019Quote: Etv2-tdTomato ES cells18 is dissociated into single cell suspension and incubated with 1μM of VPD450 (BD Horizon™) in PBS for 10 minutes at room temperature ...
-
bioRxiv - Immunology 2021Quote: Single cell suspensions were stained with conjugated antibodies and data were obtained on a BD LSR II (BD Biosciences) and analyzed with FlowJo software (Treestar) ...
-
bioRxiv - Microbiology 2021Quote: ... bacterial isolates were streaked for single colonies onto Brain Heart Infusion (BHI, Becton Dickinson [BD], Franklin Lakes, NJ, USA) agar plates from frozen glycerol stocks ...