Labshake search
Citations for Lucigen :
451 - 500 of 1243 citations for DNA Damage 8 OHdG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... genomic DNA was extracted by adding 4 volumes of QuickExtract DNA Extraction Solution (Epicentre Cat. # QE09050) to the cells ...
-
bioRxiv - Genetics 2024Quote: ... genomic DNA was extracted by adding 4 volumes of QuickExtract DNA Extraction Solution (Epicentre, Cat # QE09050) to the cells ...
-
bioRxiv - Genetics 2021Quote: ... and four CS (line 403 subclones 1, S7, S8, and S9) iPSC lines was extracted using quick extract DNA extraction solution (Epicentre #QE09050), amplified by PCR ...
-
bioRxiv - Microbiology 2024Quote: ... the amplified DNA was cloned into the pETite N-His vector (Expresso™ T7 cloning and expression system, Lucigen, # 49001-1), resulting in constructs with an N-terminal 6x His tag ...
-
bioRxiv - Molecular Biology 2020Quote: Quick extract DNA extraction solution (Lucigen) was tested in accordance with the manufacturer’s suggested buffer to sample ratio ...
-
bioRxiv - Microbiology 2021Quote: ... and DNA extraction with QuickExtract (EpiCentre) was performed ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA was harvested with QuickExtract (Lucigen) according to manufacturer protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... QuickExtract DNA Extraction solution from Lucigen; EDTA-free Complete Protease Cocktail from Roche ...
-
bioRxiv - Genetics 2024Quote: ... DNA Quick Extract (Lucigen # 76081-766) was used to isolate DNA ...
-
bioRxiv - Microbiology 2024Quote: DNA was prepared using MasterPure (Epicentre) from 500 μL samples from overnight cultures of constructed clones or evolving populations grown at 30 °C or 37 °C in LB ...
-
bioRxiv - Cell Biology 2020Quote: ... genomic DNA templates were prepared by lysing cells in QuickExtract DNA extraction solution (Lucigen, Cat No. QE0905T). Target regions were amplified by using specific PCR primers (ETV2_F ...
-
bioRxiv - Cell Biology 2022Quote: ... The homology arms were amplified from extracted HEK-293 cell genomic DNA (QuickExtract DNA extraction solution, Lucigen). The fidelity of all constructs was confirmed by Sanger sequencing prior to use.
-
bioRxiv - Cell Biology 2022Quote: ... the individual clones were expanded and the DNA was isolated using the QuickExtract DNA Extraction Solution (Lucigen). A successful homozygous genomic modification was confirmed by PCR (data not shown ...
-
bioRxiv - Neuroscience 2023Quote: Genomic DNA from human iPSC-RPE was isolated by adding 40 µL QuickExtract DNA Extraction Solution (Lucigen) to each well ...
-
bioRxiv - Cancer Biology 2023Quote: ... linear contaminant DNAs within the crude circular DNA are digested with Plasmid-Safe ATP-dependent DNase (Lucigen) at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Genomics 2023Quote: ... About 20,000 prepared barcode beads were resuspended in 40 μl enzyme buffer (1 U/μl Fast-Link DNA Ligase (Lucigen, E0077-2-D3), 20% End-It Enzyme Mix (Lucigen ...
-
bioRxiv - Microbiology 2020Quote: Transposon mutagenesis was performed using the EZ-Tn5™
1>Tnp Transposome™ Kit (Epicentre), according to manufacturer’s specifications ... -
bioRxiv - Cell Biology 2020Quote: ... genomic DNA was isolated from single cell clones using the QuickExtract DNA extraction solution (Epicentre/Lucigen, Middleton, WI) according to manufacturer’s instructions and analyzed for the presence of the wildtype and knock-in Lmna allele by PCR using the GoTaq green master mix (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... genomic DNA was isolated from single cell clones using the QuickExtract DNA extraction solution (Epicentre/Lucigen, Middleton, WI) according to manufacturer’s instructions and analyzed for the presence of the wildtype and knock-in Lmna allele by PCR using the GoTaq green master mix (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA was extracted from modified cell lines using QuickExtract DNA extraction buffer (Epicentre Technologies, Madison, Wisconsin, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... the genomic DNA derived from transfected single cell colonies was extracted with QuickExtractTM DNA Extraction Solution (QE09050, Epicentre) for Sanger sequencing and the genomic DNA with biallelic editing was further subjected to whole-genome sequencing ...
-
bioRxiv - Molecular Biology 2020Quote: ... genomic DNA was harvested using QuickExtract (Lucigen), and was saved until library preparation and sequencing.
-
bioRxiv - Biophysics 2020Quote: ... genomic DNA was isolated using QuickExtract (Lucigen), the sgRNA-targeted sites were PCR amplified and then NGS-sequenced via Genewiz’s EZ-Amplicon service ...
-
bioRxiv - Neuroscience 2021Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed using Q5® High-Fidelity DNA Polymerase according to the manufacturer’s protocol (Forward primer ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA was extracted using QuickExtract (Lucigen) as previously described (21) ...
-
bioRxiv - Genetics 2020Quote: ... Genomic DNAs were extracted by QuickExtract (Epicentre) solution and amplified by Phusion High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Cancer Biology 2019Quote: ... containing 30μl QuickExtract DNA Extraction Solution (Lucigen). A full plate containing the reaction mixture (single colony + extraction solution ...
-
bioRxiv - Cell Biology 2019Quote: ... genomic DNA was extracted with QuickExtract (Epicentre) and indels were determined by amplification of the sgRNA target site by polymerase chain reaction using Herculase II Fusion DNA Polymerase (Agilent biotechnologies ...
-
bioRxiv - Immunology 2022Quote: ... and genomic DNA isolated using QuickExtract (Lucigen). The gRNA binding sites were amplified using KOD Hot Start Polymerase (Merck ...
-
bioRxiv - Neuroscience 2023Quote: QuickExtract™ DNA Extraction Solution (QE09050, Lucigen) was used to extract gDNA from the subclones for PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted using QuickExtract (Epicentre) and PCR amplified across sgRNA sites (Table S1) ...
-
bioRxiv - Bioengineering 2023Quote: ... Genomic DNA was extracted using QuickExtract (Lucigen) and the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... Genomic DNA was isolated using QuickExtract (Epicentre), incubated at 65°C for 6 minutes followed by an incubation at 95°C for 2 minutes using a thermal cycler ...
-
bioRxiv - Cell Biology 2024Quote: ... Genomic DNA was collected using QuickExtract (Epicentre). Genotyping PCRs were performed with MyTaq HS Red Mix (Bioline) ...
-
bioRxiv - Physiology 2024Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed ATG F (TGGAATCTTCTGAACAGGTGGA ...
-
bioRxiv - Neuroscience 2023Quote: DNA was prepared by either QuickExtract (Lucigen) from iPSCs or Qiagen DNeasy columns (MSNs and U2OS ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50 μL DNA QuickExtract solution (Lucigen QE09050) was added ...
-
bioRxiv - Neuroscience 2023Quote: ... Genomic DNA was extracted with QuickExtract (Lucigen) and PCR was performed using Q5® High-Fidelity DNA Polymerase according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Klenow DNA Polymerase (KP810250, Epicentre, Madison, Wisconsin), and T4 Polynucleotide Kinase (EK0031 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR screening of the colonies was performed using genotyping oligos listed in Supplementary Table 1 using Quick Extract DNA Extraction Solution (Lucigen Catalog Number: QE09050) according to manufacturer’s protocol in a PCR machine and DreamTaq Green Polymerase (Thermo Fisher Scientific Catalog Number ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA of the two parents and the F2 progeny was extracted with the QuickExtract DNA Extraction Solution (Lucigen, QE0905T) according to manufacturer’s protocol with modifications ...
-
bioRxiv - Immunology 2022Quote: Genotyping was performed by extracting genomic DNA from fin clips or larvae using the QuickExtract DNA extraction solution (Epicentre) and amplifying loci using EMBL in-house Phusion polymerase ...
-
bioRxiv - Genetics 2023Quote: ... cells were washed once with 500 µl PBS and genomic DNA was harvested using QuickExtract DNA extraction solution (Epicentre) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... from lysate of the filamentous bacterial fraction acquired by incubation for 8 hours with 10 U/µl Ready-lyse lysozyme (Epicentre). The sequencing library was prepared using the Nextera XT kit and sequenced the same way as for the SAGs.
-
bioRxiv - Genetics 2022Quote: ... MTR4 or mtr4-1 cells was isolated using the MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen). Cells were incubated in 2 mL of Leu-minimal medium at 30°C and grown to saturation overnight ...
-
bioRxiv - Genetics 2022Quote: ... MTR4 or mtr4-1 cells was isolated using the MasterPure™ Yeast RNA Purification Kit (Epicentre, Lucigen). Cells were incubated in 2 mL of Leu-minimal medium at 30°C and grown to saturation overnight ...
-
Transcriptional dissection of symptomatic profiles across the brain of men and women with depressionbioRxiv - Neuroscience 2023Quote: ... RNA libraries were synthesized from 1 μg of RNA using the ScriptSeq Complete Gold Kit (Epicentre, Illumina) including an initial ribosomal RNA depletion step ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA was isolated from candidate RIG-I or IRF3 KO cell clones using the QuickExtract DNA extraction solution (Epicentre). Genomic DNA isolated from the RIG-I or IRF3 KO cell clones was then amplified by PCR using primers spanning exon 1 for RIG-I or exon 2 for IRF3 (see Table 1) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Aliquots from these lysates were used for a PCR (with a Taq DNA polymerase with standard Taq buffer NEB or EconoTaq DNA polymerase Lucigen) with respective gene primers and an 18mer M13F-FAM fluorescent tagged primer (5’-TGTAAAACGACGGCCAGT-3’ ...