Labshake search
Citations for Lucigen :
101 - 150 of 460 citations for 6 Chloro 5 6 dihydroimidazo 1 5 a pyrido 3 2 e pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... DNAse-treated RNA (5 µg) was mRNA enriched using a Ribo-Zero Magnetic Kit (Epicentre). After Illumina sequencing the reads were mapped to C ...
-
bioRxiv - Microbiology 2020Quote: Synthetic RNA H4 (26) was radiolabeled at its 5’ end using T4 polynucleotide kinase (Epicentre) and [γ-32P]ATP (Perkin Elmer) ...
-
bioRxiv - Microbiology 2023Quote: ... 250 pmol of Qβ-RNA were treated with 60 U of RNA 5’-polyphosphatase (Epicentre) in 1 x polyphosphatase reaction buffer at 37 °C for 70 min ...
-
bioRxiv - Genetics 2023Quote: ... 400 ng of DNA was incubated with 5 U Plasmid-Safe ATP-Dependent DNase (Lucigen), 25 mM ATP solution ...
-
bioRxiv - Genomics 2024Quote: ... the DNA & rRNA depleted RNA samples were treated with Terminator 5’-Phosphate-Dependent Exonuclease (Lucigen). After a one-hour incubation ...
-
bioRxiv - Genomics 2020Quote: ... 2.5 μL of T4 polynucleotide kinase (5 U/μL) plus 2.5 μL 10X Reaction Buffer (Lucigen) were added to the initial 20-μL nucleic acids solution ...
-
bioRxiv - Molecular Biology 2021Quote: Synthetic RNA substrate H4 (34) was radiolabeled at its 5’ end using T4 polynucleotide kinase (Epicentre) and [γ-32P]ATP (Perkin Elmer ...
-
bioRxiv - Plant Biology 2019Quote: ... size-selected DNA fragments (150-350kb) were ligated into HindIII digested vector pIndigoBAC-5 (Epicentre, USA) and transformed into E ...
-
bioRxiv - Molecular Biology 2023Quote: ... and excess unligated linker was removed using 10 U/µl 5’ deadenylase/RecJ exonuclease (Epicentre, RJ411250), followed by pooling and purification of ligated footprints using an Oligo Clean and Concentrator column (Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... using a Gibson assembly master mix (New England Biolabs).Gibson assembly products were transformed into electrocompetent cells (E. cloni, Lucigen) and plated on 245mm x 245mm square LB-agar plates to obtain the sufficient number of bacterial colonies at a ∼50× library coverage ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs) was achieved by incubation of the RNA with the Terminator 5’-Phosphate-Dependent Exonuclease (TEX, Lucigen). For this purpose ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was depleted from the purified nsRNA fraction using Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen TER51020) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 10 μg of total RNA of each strain was treated with RNA 5’-Polyphosphatase (Epicentre, Madison, Wisconsin). The dephosphorylated RNAs were self-ligated by T4 RNA ligase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: 5 µg of extracted RNA was depleted from ribosomal RNA using Ribo-Zero Gold Kit (Epicentre Madison). After fragmentation of the rRNA-depleted RNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μg of total RNA were treated by 1MBU of DNAse (BaseLine-Zero™ DNAse, Epicentre, USA) for 20 min at 37°C to remove residual genomic DNA contamination ...
-
bioRxiv - Genomics 2019Quote: ... 5 μg of RNA were used for rRNA depletion following the Ribo-Zero Magnetic Kit instructions from Epicentre-Illumina (Cat.no ...
-
bioRxiv - Microbiology 2022Quote: ... two µg of total RNA were treated with 5 U of RNase R (cat. # RNR07250, Lucigen, Middleton, WI) for 40 min at 37 °C ...
-
bioRxiv - Systems Biology 2019Quote: ... Ligation of the 5’ adapter (P5_phospho_adapter, oligo 39) to the cDNA was performed using CircLigase II (Lucigen, CL9021K) for 6 hours at 60°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the (+)SHAPE and (−)SHAPE RNA samples were treated with Terminator™ 5′-Phosphate-Dependent Exonuclease (TER51020, EPICENTRE co.), which processively digests RNA with 5′-monophosphate ends ...
-
bioRxiv - Cell Biology 2023Quote: Cells plated on glass coverslips were incubated with 5 µg/mL Brefeldin A (BFA) (Epicentre Biotechnologies, Madison, WI) for 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were chilled on ice for 5 minutes and 175 μl of MPC protein precipitation solution (Lucigen, USA) was added to 300 μl of the lysed sample and vortexed vigorously for 10 seconds ...
-
bioRxiv - Molecular Biology 2019Quote: Proteinase K sensitivity experiments were performed using 1.5ug (protein) of gradient-purified EVs treated with 5 ug /mL Proteinase K (Epicentre) in the absence or presence of 0.05% Triton X-100 at 37°C for 30 min ...
-
bioRxiv - Systems Biology 2019Quote: Ten micrograms of total RNA extracted from cell-samples at OD600 1.2 and 1.8 were treated with 5’-Terminator Dependent Exonuclease (Lucigen, TER51020) as per manufacturer instructions using Buffer A ...
-
bioRxiv - Molecular Biology 2022Quote: ... Circular ssDNA substrate was prepared by circularisation of 5’-32P labelled TK-49 using CircLigase II (Lucigen cat#CL9021K), according to manufacturer recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 5 min.The successful linearization of ecDNA was verified by verifying its sensitivity to exonucleaseATP-dependent DNase (Lucigen). After treatment with exonuclease ...
-
bioRxiv - Genetics 2022Quote: ... single BFU-E and CFU-GM were lysed with QuickExtract Lysis Buffer (Epicentre). CFCs were incubated at 65°C for 20 min followed by an incubation at 98°C for 10 min and centrifuged at 13000 rpm for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: The NDM libraries are then transformed into Escherichia coli (E. cloni 10G, Lucigen) and stored as glycerol stocks ...
-
bioRxiv - Plant Biology 2021Quote: ... both fractions were combined and all subsequent steps performed as previously described (Pfeifer-Sancar et al., 2013) except that the clean-up of RNA 5’-pholyphosphatase (Epicentre)-treated samples was performed by Clean & Concentrator column purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... Metatranscriptomic libraries were prepared for sequencing with the addition of 5–50 ng of RNA to the ScriptSeq cDNA V2 library preparation kit (Epicentre). Metatranscriptomic samples were sequenced with an Illumina NextSeq 500 system using V2 high output 300 cycle reagent kit with PHIX control added ...
-
bioRxiv - Genetics 2019Quote: ... or 2µg (25th and 100th generation samples) of RNA were incubated for 1h at 37°C with 5’ RNA polyphosphatase (Epicentre) at a final concentration of 1U/µl ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs and other uncapped RNA species were depleted from RNA samples using the Terminator™ 5’-Phosphate-Dependent Exonuclease (Lucigen). Following a standard phenol-chloroform-isoamyl precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Neuroscience 2023Quote: 10ug of Trizol-extracted RNA from mouse cortex and striatum was treated with Terminator 5’-Phosphate dependent exonuclease (Lucigen TER51020) according to manufacturer’s protocol. ...
-
bioRxiv - Biochemistry 2023Quote: ... the library was electroporated into Escherichia coli cells (E. cloni 10G Elite; Lucigen, USA), yielding ≈ 107 colonies after overnight incubation on agar plates ...
-
bioRxiv - Molecular Biology 2020Quote: ... by annealing locus-specific oligonucleotides to a common 5’ universal oligonucleotide and performing in vitro RNA transcription (AmpliScribe T7-Flash Kit, Lucigen, ASF3507)40 ...
-
bioRxiv - Bioengineering 2020Quote: The 5′-biotinylated-E07 (anti-EGFR aptamer) was generated by performing an in vitro transcription reaction (DuraScribe T7 Transcription Kit, Lucigen, #DS010925), as described previously (Ray et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The suspension was spun down at 5,000 x g for 5 minutes and the pellet was resuspended in 100 µl of QuickExtract™ DNA Extraction Solution (Lucigen) and 0.1 µl Ready-Lyse™ Lysozyme solution (Epicentre ...
-
bioRxiv - Developmental Biology 2022Quote: ... These solutions (5.5 µl each) were then used as template for a 20 µl reaction with the AmpliScribeTM T7 Transcription Kit (Lucigen, AS3107). The reaction product was treated with DNAseI and shRNAs were purified using the RNA Clean and ConcentratorTM Kit (Zymo Reasearch ...
-
bioRxiv - Synthetic Biology 2022Quote: Yeast genomic DNA was prepared from 5 mL stationary phase culture either with the MasterPure™ Yeast DNA Purification Kit (Lucigen) according to the manufacturer guidelines or using the Cetyl Trimethyl Ammonium Bromide (CTAB ...
-
bioRxiv - Biochemistry 2022Quote: ... the CleanNGS elute was adjusted to 25ul with 10mM Tris pH 7.5 and the ends of the digested DNA were repaired and phosphorylated at their 5’ end using the End-It DNA End-repair kit (Lucigen #ER0720). DNA was purified using MinElute PCR Purification Kit (QIAGEN #28006) ...
-
bioRxiv - Genetics 2023Quote: ... at least 30 5-FOA resistant clones were grown in YEPD for DNA extraction by MasterPure™ Yeast DNA Purification Kit (Lucigen). The relative location of each chromosome truncation event was determined using multiplex PCR with primers that anneal centromere or telomere proximal to the SiRTA (File S1) ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing libraries were then prepared from 5 ng of DNA by performing end-repair with the End-it DNA End-Repair Kit (Lucigen, ER81050), followed by A tailing with NEB Klenow Fragment (3’−5’ exo- ...
-
bioRxiv - Biochemistry 2024Quote: ... Fragments sized between 30 and 40 kb were isolated as previously described (Tasse et al., 2010) and cloned into pEPIFOS-5 fosmids (Epicentre Technologies). EPI100 E ...
-
bioRxiv - Plant Biology 2020Quote: A BAC library was constructed with pIndigoBAC-5 (Hind III-Cloning Ready) for a heterozygous resistant plant K182 carrying the Rpi-mcq1 followed the instrument (Epicentre, WI, USA). The library is approximately 9× coverage with an average insert size of 85 kb ...
-
bioRxiv - Microbiology 2021Quote: ... The reconstructed product OmRV-fragment1/pACYC177 was then transformed into 10G chemically competent cells (Lucigen, E. cloni), propagated for plasmid purification with the aforementioned method ...
-
bioRxiv - Cell Biology 2019Quote: ... according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E, Epicentre). The presence of MAD1 E53/56K substitutions was identified through PCR using forward primers annealing to the mutated or the wild type sequences (AGCTGGAAAAGAGGGCGAAAC and TAAGTGCCGGGAGATGCTG ...
-
bioRxiv - Biochemistry 2020Quote: ... at 37°C (1 – 2 h) and 1 μl from PCR reaction aliquots were transformed in electrocompetent E.coli Cloni® 10G cells (Lucigen, USA). Colonies were screened by colony PCR and sequenced.
-
bioRxiv - Microbiology 2020Quote: ... end-repaired DNA from PoV-01B (1-2 Kb) were prepared by Lucigen (https://www.lucigen.com/) using the pSMART-HCKan cloning vector (Lucigen,WI ...
-
bioRxiv - Microbiology 2021Quote: ... 100µl of competent cells was mixed with 1 µl of EZ-Tn5 KAN-2 Tnp Transposome (Epicentre) and electroporated at 1800V ...
-
bioRxiv - Microbiology 2021Quote: ... OmRV-fragment2/pMA (ampicillin resistant) and pACYC177 low-copy-number plasmids were transformed into 10G chemically competent cells (Lucigen, E. cloni), respectively ...