Labshake search
Citations for Lucigen :
1 - 50 of 460 citations for 6 Chloro 5 6 dihydroimidazo 1 5 a pyrido 3 2 e pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... cloni 5-alpha (short: E. cloni, Lucigen corporation) for all cloning procedures ...
-
bioRxiv - Microbiology 2022Quote: ... The pilT gene and flanking sequence from the FA1090 chromosome was amplified by PCR with primers PilT-F 5’-CATTGAGGTCGGCAAGCAGC-3’ and PilT-R 5’-GCATCTTTACCCAGCGCGAAAT-3’ and cloned into pSMART HC Kan (Lucigen). The cloning mix was transformed into TOP10 E ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Microbiology 2021Quote: ... 3-5 μl Hybridase™ Thermostable RNase H (Lucigen) and 7 μl 10x RNase H buffer preheated to 45°C was added ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... followed by addition of 6 mL of recovery medium (Lucigen, F98226-1) and incubation at 37 °C for one hour at 280 rpm rotation ...
-
bioRxiv - Microbiology 2023Quote: ... Successful RppH treatment was verified by incubating 100 ng of 5’P or 5’PPP transcripts with 20 U RiboLock and 1 U Terminator™ 5’Phosphate-Dependent Exonuclease (Lucigen) in 1x TEX Buffer B for 30 min at 42°C ...
-
bioRxiv - Genetics 2019Quote: ... 5 μL FailSafe 2× PCR premix G (EpiCentre, Madison, Wisconsin), approximately 25 ng genomic DNA template ...
-
bioRxiv - Microbiology 2021Quote: ... 5’PPP structures were then converted into 5’P ends using RNA 5’ Polyphosphatase (5’PP, Epicentre), to which RNA adapters were ligated ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of rRNA-depleted RNA were treated with 1 U Terminator 5’-Phosphate-Dependent Exonuclease (Epicentre) in the 1x Buffer A in the presence of 40 U RNaseOUT in a 50 μL reaction at 30 °C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... to decap linear RNA and then was degraded using Terminator 5’-3’ exonuclease (Lucigen). The resulting RNA was put through a size selection step to remove ≤200 nts RNA using SPRI paramagnetic beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 3’end of resultant cDNAs were ligated to a ssDNA linker (5’-PhosNNNAGATCGGAAGAGCGTCGTGTAG-/3SpC3/3’) using Circligase ssDNA Ligase (Epicentre) at 65°C for 12 hrs ...
-
bioRxiv - Molecular Biology 2023Quote: ... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-deadenylase (Epicentre) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Microbiology 2024Quote: ... the 5’PPP structures were removed using RNA 5’ polyphosphatase (Epicentre). Afterwards ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Immunology 2019Quote: 1ug of total cellular RNA was treated with RNA 5’ polyphosphatase (enzyme that converts 5’-triphosphorylated RNA into 5’-monophosphorylated RNA, Lucigen) for 30 min at 37°C or mock-treated ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA samples were polyA-tailed and 5’-PPP-ends were trimmed to 5’-P-ends via RNA 5’-polyphosphatase (Epicentre). First-strand cDNA synthesis was performed using an oligo(dT)-adapter and M-MLV reverse transcriptase followed by high-fidelity PCR amplification of the cDNA using primers suitable for Illumina TruSeq sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 µg RNA was incubated with 5 U RNase R (#RNR07250; Epicentre) in 1× RNase R buffer (#RNR07250 ...
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-deadenylase (Epicentre, DA11101K) was used to deadenylate the pre-adenylated linkers ...
-
bioRxiv - Genomics 2022Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30°C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2023Quote: ... coli colonies were picked into 3-5 mL LB-Kan supplemented with CopyControl Induction Solution (Lucigen CCIS125) and cultured overnight at 30 °C with shaking at 220 RPM ...
-
bioRxiv - Genomics 2022Quote: ... 5 μg RNA were digested with 1 U RNase R (Epicentre) per μg RNA in a total reaction volume of 10 μl for 10 min at 37°C ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (6 μg) from HG003 Δfur was treated with TAP (Epicentre) for 1 h at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... the circularization mixture was combined with 6 μl 10X Plasmid-Safe Buffer (Lucigen), 2 μl Plasmid-Safe Enzyme (Lucigen) ...
-
bioRxiv - Microbiology 2020Quote: ... 6 μl Baseline Zero DNAse (0.1 U/μl, Epicentre Technologies, Madison, WI, USA), 1 μl Benzonase (1 U/μl ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg of total RNA was treated with the RNA processing enzyme RNA 5′-polyphosphatase (Epicentre) to convert 5′-triphosphate RNA or 5′-diphosphorylated RNA to 5′-monophosphate RNA without dephosphorylating monophosphorylated RNA ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 U RecJ exonuclease (Epicentre). Up to 8 libraries were pooled ...
-
A conserved isoleucine in the binding pocket of RIG-I controls immune tolerance to mitochondrial RNAbioRxiv - Immunology 2022Quote: RNA 5’Polyphosphatase (Lucigen, Middleton, USA) was used to generate 5’p-RNA from IVT 5’ppp-RNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl RNase R mixture (Epicentre) was added to the sample before incubation at 37°C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... 5 U Baseline-ZERO DNase (Epicentre), 25 U Benzonase (Sigma Aldrich) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μl of RNase inhibitor (Lucigen) and 450 μl of IP buffer (150 mM NaCl ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μl of the reaction was used to transform 25 μl of Endura electrocompetent cells (Lucigen; 60242-2) according to the manufacturer’s protocol using a Gene Pulser (BioRad) ...
-
bioRxiv - Genetics 2024Quote: ... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and 1.5 μL of 5 U μL-1 Ampligase Thermostable DNA Ligase (Lucigen, USA). Water was added to a total volume of 25 μL ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA fragments were poly(A)-tailed and 5’PPP structures were removed with RNA 5’ Polyphosphatase (Epicentre). The RNA sequencing adapter with the barcodes were ligated to the 5’-monophosphate of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... coli 5-alpha Chemically Competent cells (Lucigen), performing a thermal shock for 45 seconds at 42°C followed by 2 minutes on ice ...
-
bioRxiv - Biochemistry 2019Quote: ... transcripts were treated with 5’-polyphosphatase (Epicentre) and Xrn1 (New England Biolabs ...
-
bioRxiv - Biochemistry 2019Quote: ... transcripts were treated with 5’-polyphosphatase (Epicentre) and Xrn1 (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Terminator 5’-Phosphate Dependent Exonuclease (Lucigen) (1 U per 5 μg of RNA ...
-
bioRxiv - Molecular Biology 2023Quote: Terminator™ 5′-Phosphate-Dependent Exonuclease (Lucigen) was used to enrich the 5′ ends of the transcripts ...
-
bioRxiv - Genomics 2019Quote: ... and the 5’P of capped molecules was exposed by treatment with 5 units of Tobacco Acid Pyrophosphatase (Epicentre). RNA samples were ligated with the TIF-seq DNA/ RNA 5oligo cap using T4 RNA ligase 1 (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... The ssDNA linker containing a 5′ phosphate and 3′ C3 spacer was ligated to the synthesized cDNA using 20 U of the Circligase I (Lucigen, Middleton, WI). The resultant cDNA was amplified by an adapter-based PCR using the KAPA HiFi DNA polymerase (Roche ...
-
bioRxiv - Microbiology 2023Quote: Tn-5 transposon insertion library was build based on EZ-Tn5™
2>Tnp transposome system (Lucigen, WI, USA). Competent C ... -
bioRxiv - Molecular Biology 2023Quote: ... The RNA was then poly(A)-tailed using poly(A) polymerase and the 5’-PPP was removed using 5’ polyphosphatase (Epicentre). RNA adaptors were then ligated and synthesis of first strand cDNA was performed using M-MLV reverse transcriptase and oligo(dT ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.5 µl Hybridase (Lucigen, H39500, 5 units/µl) and 2.5 µl water were added to the mix ...