Labshake search
Citations for Lucigen :
51 - 100 of 139 citations for 3 Phenoxybenzoic Acid Unlabeled 100 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were collected after 3 days and lysed with QuickExtract DNA Extraction Solution (Lucigen): endogenous loci were PCR amplified with HOT FIREPol MultiPlex Mix (Solis BioDyne) ...
-
bioRxiv - Developmental Biology 2023Quote: ... We exposed the nucleic acids of each embryo with 5µl of QuickExtract™ DNA Extraction Solution (Lucigen, VWR, Philadelphia, PA), and incubated at 65°C for 15 minutes followed by 2 minutes at 98°C.
-
bioRxiv - Microbiology 2021Quote: ... filled with 1 ml LB supplemented with 25 μg/ml chloramphenicol and 2 µl/ml CopyControl fosmid autoinduction solution (Epicentre Biotechnologies, Cat. No. AIS107F). The plates were grown at 30 °C shaking at 700 RPM for 16 h covered by an AeraSeal gas-permeable sheet (EXCEL Scientific Cat ...
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library preparation was performed using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using the Quantseq 3’ mRNA-Seq Library Prep Kit FWD (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... 2 mL of recovery buffer (Lucigen) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 U/ml Rnase Inhibitor (Lucigen), 2.5 μM Template Switch Oligo ...
-
bioRxiv - Genomics 2021Quote: ... 1 ml of recovery media (Lucigen) was added ...
-
bioRxiv - Genomics 2021Quote: ... 1 ml of recovery media (Lucigen) was added ...
-
bioRxiv - Plant Biology 2021Quote: ... The RNA (1-3 μg) was then treated with 5 units of RNase R (Lucigen. RNR07250) for one hour at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... TSS mapping was performed using an ExactSTAR Eukaryotic mRNA 5’- and 3’-RACE Kit (Epicentre Biotechnologies) as described in the manufacturer’s guidelines ...
-
bioRxiv - Synthetic Biology 2020Quote: Transposon Cassettes were inserted into pNL4-3 by in vitro transposition with EZ-Tn5 transposase (Epicentre) per manufacturer’s protocol and with equal mols of plasmid template and transposon ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) Poly(A)-tailing to add adenosines to the open 3’ ends of RNA (Lucigen, #PAP5104H), and 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates containing 3 μg of total RNA were treated with 20 U of RNase I (Lucigen) for 45[min at 25°C and then subjected to a sucrose cushion ultracentrifugation at 100,000[rpm for 1[h at 4°C with Optima MAX-TL ultracentrifuge and TLA-110 rotor (Beckman Coulter) ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid extraction from blood samples was performed using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, LGC Ltd, Teddington, GB). For metagenomic analysis ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 U/mL Baseline-Zero DNase (Lucigen), and 0.5 mM PMSF ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/L fosmid autoinduction solution (Epicentre), each plate supplemented with 0.3% (v/v ...
-
bioRxiv - Genomics 2020Quote: ... media was aspirated and 50-100 μL QuickExtract™ DNA Extraction Solution (Lucigen) were added to each well ...
-
bioRxiv - Microbiology 2022Quote: ... 1% Triton X-100) containing 50 U/μL Ready-Lyse Lysozyme (Lucigen #R1804M) and protease inhibitors ...
-
bioRxiv - Genetics 2019Quote: ... The cell pellet was agitated in 100 μL of QuickExtract DNA Solution (Lucigen) to disrupt the pellet and placed in a thermocycler for 15 minutes at 68°C followed by 10 minutes at 95°C ...
-
bioRxiv - Biophysics 2023Quote: ... Genomic DNA was extracted 3 days post-transfection using QuickExtract DNA Extraction Solution 1.0 (Lucigen Corporation QE09050). To test the cutting efficiency ...
-
bioRxiv - Microbiology 2023Quote: ... The culture was diluted again to 400 mL of LB30 medium + 12.5 μg/mL of chloramphenicol + 1x Arabinose induction solution (Lucigen) for overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 ng of library was added to 25 µL of Endura electrocompetent cells (Lucigen). Cells were electroporated using the MicroPulser (BioRad ...
-
bioRxiv - Systems Biology 2020Quote: ... the fragmentation of 100 pg cDNA was performed with EZ Tn5 Transposase (Lucigen, TNP92110). Fragments of cDNA were amplified by KAPA HiFi hotstart readymix (EMSCO/FISHER ...
-
bioRxiv - Microbiology 2023Quote: ... Transposomes were prepared using 100 ng transposon DNA and EZ-Tn5 transposase (Lucigen, USA) according to the suppliers specifications ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The circular ssDNA template was prepared by circularizing: P-5’TATGCCCAGCCCTGTA AGATGAAGATAGCGCACAATGGTCGGATTCTCAACTCGTATTCTCAACTCGTAT TCTCAACTCGTCTCTGCCCTGACTTC-3’ with CircLigase™ (Lucigen) according to the manufacturer protocol ...
-
bioRxiv - Microbiology 2021Quote: ... resuspended a 0.5 mL ReadyLyse lysozyme solution (Epicentre), and then sample incubated for one hour at 37°C with shaking ...
-
bioRxiv - Systems Biology 2021Quote: ... and 52.5 kU/mL of ready-lyse (Epicentre); 600 µL per pellet (stationary phase cells were diluted 10x prior to lysis ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 50 U/ml RNase I (Lucigen, N6901K) for 30 minutes at room temperature with gentle mixing ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 1 μL/mL Ready-Lyse Lysozyme Solution (Lucigen) and 1 μL/mL benzonase nuclease (Sigma) ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 U/ml Baseline-ZERO DNase (Lucigen #DB0715K), 100 U/ml RNasin (Promega #N2611) ...
-
bioRxiv - Neuroscience 2021Quote: The completed constructs in M-6-attB-UAS-1-3-4 vector were amplified in Epi300 competent cells (EpiCentre) in LB-Chloramphenicol medium ...
-
bioRxiv - Molecular Biology 2021Quote: ... Collagenase and EDTA solutions were prepared with RNAse inhibitor added (1:100 ratio, Lucigen, 30281). Isolation buffer is composed of 70 mM NaCl ...
-
bioRxiv - Genetics 2020Quote: DNA was isolated from each of the four cell pools with 100 µL QuickExtract (Lucigen) per 1 million cells following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μL/mL Ready-Lyse™ Lysozyme Solution (Lucigen) and 1 μL/mL benzonase nuclease (Sigma) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Electroporations were recovered in 1 mL recovery media (Lucigen) for 1 hour and subsequently grown overnight in LB + selection.
-
bioRxiv - Neuroscience 2019Quote: ... a 3-axis micromanipulator with borosilicate glass electrodes was used to pick up cells into 3µL of lysis buffer (Epicentre, MessageBOOSTER), their ROI identifier was recorded ...
-
bioRxiv - Genomics 2020Quote: ... Multiple PCR reactions for each sample were carried out with 200 pg of annealed DNA using the XpYpE2 and teltail primers (Supplementary Table 3) and FailSafe PCR reagents (Epicentre). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ ends of the restricted and CPD-incised DNA fragments were ligated to Illumina sequencing adapters by using Circligase (Lucigen). After PCR amplification ...
-
bioRxiv - Biochemistry 2024Quote: ... and TetraCys-tagged LexAPaCTD were amplified from the genomic DNA using primers LexA_Pa.For/Rev and LexA_Pa_CTD_4Cys.For/Rev (Supplementary Table 3) and cloned in pETite C-His Kan vector and pETite N-His SUMO Kan Vector (Lucigen), respectively ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with QS solution (1.5 M NaCl, 100 mM MOPS, 15% v/v isopropanol) and PlasmidSafe (Epicentre) were used in lieu of the Qiagen Large Construct Kit and Qiagen exonuclease ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 ml of 37 °C Recovery Medium (Lucigen, 80026-1) was added and bacteria were grown in round-bottom tubes for 1 h at 37 °C while shaking at 180 r.p.m ...
-
bioRxiv - Immunology 2023Quote: ... Immediately after electroporation 1 ml of prewarmed recovery medium (Lucigen, #800261 was added to the bacteria and the cells were incubated for 1 hour at 37 °C shaking at 250 rpm in a bacterial incubator ...
-
bioRxiv - Immunology 2019Quote: ... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
bioRxiv - Cell Biology 2021Quote: Total RNAs was treated with RNase R for 30 min at 37°C using 3 U/mg of RNase R (Lucigen, USA). HCC-LM3 and Huh-7 cells treated with actinomycin D (1 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... the genes encoding the three isoforms of hnRNPDL (hnRNPDL-1, hnRNPDL-2 and hnRNPDL-3) were inserted into pETite (Lucigen corporation) vector with a His-SUMO N-terminal tag ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was repaired with Blunt-end ending 3′ overhang using End-It DNA End-Repair kit in 25 µl volume (Epicentre; ER81050), and 3′-A overhang was added with Klenow fragment (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... we pooled all mice into the same tube containing a hypertonic lysis buffer (10mM Tris-HCl, 10 mM NaCl, 3 mM MgCl2, 0.1% Igepal, 0.2 U/μl Lucigen NxGen Rnase inhibitor). Nuclei were extracted using a glass dounce homogenizer (DWK ...