Labshake search
Citations for Lucigen :
301 - 350 of 1243 citations for DNA Damage 8 OHdG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Genomic DNA extraction using QuickExtract DNA Extraction Solution (Lucigen) was performed according to manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNAs were prepared using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... cellular genomic DNA was extracted using QuickExtract DNA solution (Epicentre) and the Gaac.1826 target locus was PCR amplified and purified using DNA Clean & Concentrator™ (Zymo Research ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen), depending on confluency 25 to 100 μl of solution was added to the wells containing the cells for 15 minutes at 37C ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... genomic DNA was extracted using Quickextract DNA extraction solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen). PCR amplified target sequence was heated to 95°C and slowly (2C/s ...
-
bioRxiv - Bioengineering 2020Quote: ... genomic DNA was isolated using QuickExtract DNA Extraction Solution (Epicentre). Two sets of PCR primers were designed ...
-
bioRxiv - Developmental Biology 2022Quote: ... Yolk-sac DNA was extracted (QuickExtract DNA Extraction Solution, Epicentre) and used for genotyping to distinguish heterozygous and homozygous Hand2 conditional allele ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was harvested using QuickExtract DNA Extraction Solution (Lucigen), and gDNA was prepared by heating to 65°C for 10 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Cell Biology 2019Quote: ... were grown overnight at 37°C with 12.5 µg of chloramphenicol and extracted using a BACMAX DNA purification kit (Epicentre). Then ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... a (modified) CTAB protocol or a rapid desalting method (MasterPure™ Complete DNA and RNA Purification Kit; Lucigen Corporation).
-
bioRxiv - Genomics 2020Quote: ... an aliquot of 25 uL was reserved from each sample for extraction of DNA with MasterPure™ kit (Epicentre) and bacterial cell count was measured using qPCR (TaqMan™) ...
-
bioRxiv - Genomics 2020Quote: ... gDNA for the rest of the strains was extracted using the Masterpure Complete DNA and RNA purification kit (Lucigen) using the protocol for tissue samples ...
-
bioRxiv - Genomics 2021Quote: ... About 30 ug of total gDNA was recovered from using MasterPure™ Complete DNA and RNA Purification kit (Lucigen), and 0.5ug-1ug gDNA was checked on a 1% agarose gel for integrity and quality ...
-
bioRxiv - Plant Biology 2021Quote: ... a PCR-free library was prepared with the NxSeq® AmpFREE Low DNA Library Kit (Lucigen, Middleton, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... 20pg of in vitro transcribed RNA synthesized from the T7 control DNA Template (AmpliScribe™ T7 Transcription Kit, Epicentre) was added to the samples ...
-
bioRxiv - Biochemistry 2023Quote: ... Isolated DNA was used to construct a fosmid library using the CopyControl™ Fosmid Library Production kit (Lucigen Corporation) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... resuspended in 20 µL circularization reaction mix (7.75 mM Tris pH 8, 1x Epicentre CircLigase buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... expanded by 16 electroporations (8 for each half library) into Endura electrocompetent cells (Lucigen), and plated on sixteen 24.5 cm bioassay plates (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using QuickExtract genomic DNA extraction solution (Epicentre Biotechnologies) and then screened by PCR amplification of the region of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... genomic DNA was extracted using QuikExtract DNA reagent (Lucigen, Middleton, WI). Except where noted ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA was isolated from obtained clones using DNA QuickExtract (Lucigen), the sgRNA-targeted sites PCR amplified and the products Sanger-sequenced ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies).
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies). C9ORF72 targeting sgRNA1 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was isolated with QuickExtract™ DNA Extraction Solution (Lucigen) and targeted sequences were amplified by PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... and genomic DNA were extracted using QuickExtract DNA Extraction Solution (Epicentre). PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoid DNA was extracted with QuickExtract™ DNA Extraction Solution (Lucigen) and PCR amplified ...
-
bioRxiv - Genetics 2023Quote: ... and extracted genomic DNA with QuickExtract DNA Extraction Solution (QE09050, Lucigen). PCR on the genomic DNA was performed to identify the presence of chromosomes with or without reporter integration56 ...
-
bioRxiv - Genetics 2021Quote: ... columns and approximately 120–150 ng of DNA was used as template for a T7 in vitro transcription (IVT) reaction (AmpliScribe-T7-Flash transcription kit from Epicentre). In vitro transcribed gRNAs were DNAse-treated using TURBO-DNAse for 20 min at 37 °C and precipitated with sodium acetate/ethanol and resuspended in RNAse and DNAse free water ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nematodes were washed individually from each mapping line in approximate equal pellet sizes prior to pooling and genomic DNA extraction using the MasterPure Kit (Epicentre). We sequenced the whole genomes of tu391 and csu60 ...
-
bioRxiv - Neuroscience 2020Quote: DNA from six PVN from each supplemental tactile stimulation group in the repeated room temperature condition and nest temperature condition (total n = 24) was extracted using the Masterpure Complete DNA/RNA Extraction kit (Epicentre) and 300 ng of DNA was used for bisulfite conversion using the Epitect Fast Bisulfite Conversion kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting air-dried pellets were resuspended in RNase-free water and 3 µg of DNA from each sample was depleted of ribosomal RNA using the Bacteria Ribo-Zero rRNA Removal Kit (Epicentre) and purified using the RNeasy miniprep kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The library prep was performed according to the manufacturer’s instructions for the NxSeq® AmpFREE Low DNA Library Kit from Lucigen® (Cat No ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from harvested cultures using the Masterpure™ Complete DNA and RNA Kit (Lucigen Corporation, Middleton, Wisconsin). RNA was subsequently purified using the Zymo RNA Clean and Concentrator™ Kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was then stopped with the addition of 190 µl lysis buffer (from MasterPure Yeast DNA Purification Kit (Lucigen)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragmented gDNA was ended-repaired in 50 μl reaction using the End-It DNA End-Repair Kit (Lucigen, ER81050), incubated at room temperature for 45 min ...
-
bioRxiv - Microbiology 2022Quote: RNA from endodontic samples was extracted using the MasterPure Complete DNA and RNA Purification Kit (Epicentre Technologies, Madison, WI, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and purified DNA-free RNA samples were subjected to ribosomal depletion with Ribo-Zero™ Magnetic Kits (Epicentre®, Singapore), all according to manufacturer’s protocols ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen, USA). Genomic PCR was performed using 100 ng genomic DNA ...
-
bioRxiv - Neuroscience 2020Quote: DNA was lysed with 50 μl QuickExtract™ DNA Extraction Solution (Lucigen). Copy numbers were analyzed by quantitative real-time PCR performed in an ABI Prism 7900 HT Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was extracted with QuickExtract™ DNA Extraction Solution (Epicentre, QE09050). Genomic PCR was carried out using Q5® High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: DNA was extracted from cells using the QuickExtract DNA Extraction Solution (Lucigen) and sequencing was performed with 110x coverage using 100 base pair paired end read lengths ...