Labshake search
Citations for Lucigen :
251 - 300 of 338 citations for Fumarase from porcine heart since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA was extracted from cell pellets as described (Greenstein et al 2018) using the Masterpure yeast RNA extraction kit (Lucigen). cDNA was produced from 2-3 g total RNA as described (Greenstein et al 2018 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was extracted from the frozen tissues (10 mg) with a MasterPure Complete DNA and RNA purification Kit (Lucigen). We used Q5®High-Fidelity 2X Master Mix (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... The resulting air-dried pellets were resuspended in RNase-free water and 3 µg of DNA from each sample was depleted of ribosomal RNA using the Bacteria Ribo-Zero rRNA Removal Kit (Epicentre) and purified using the RNeasy miniprep kit (Qiagen) ...
-
bioRxiv - Bioengineering 2022Quote: ... at 37°C (1 – 2 h) and 0.9 μl from the reaction mix were electroporated to E.coli Cloni® 10G cells (Lucigen, USA). Colony PCR and sequencing were used for analysis and verification.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The library prep was performed according to the manufacturer’s instructions for the NxSeq® AmpFREE Low DNA Library Kit from Lucigen® (Cat No ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ligated RNAs were then purified using phenol/chloroform extraction followed by ethanol precipitation and then digested using 10U RNase R from Epicentre as described in the RNase R treatment paragraph ...
-
bioRxiv - Microbiology 2021Quote: ... The vector product was sized and purified from an agarose gel and circularized by end repair/phosphorylation (Lucigen, cat#ER0720) and blunt ended ligation (Lucigen ...
-
bioRxiv - Microbiology 2020Quote: ... Positive clones that were capable of producing hydroxylamine and nitrite from ammonium were screened and sequenced using specific pCC2FOS sequencing primers (Epicentre) at SinoGenoMax (Beijing ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fig 5B-D and Fig EV5 were obtained as follows: Total RNA was extracted from cells using the MasterPure Yeast RNA Purification Kit including a DNase treatment step (Epicentre), and converted to cDNA using random primers and the RevertAid Reverse Transcriptase kit (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pombe DNA was extracted from cells grown to log phase at 32°C using MasterPureTM Yeast DNA purification kit (Lucigen/Epicentre). Genomic DNA of Ch16-Tel-DSB ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic DNA was isolated from bulk cells transfected with CRISPR/Cas9 plasmids using the epicentre QuickExtract DNA Extraction Solution (Lucigen) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... DNA was isolated from tail snips of MyD88 CRISPy TAKO and Mock-treated control offspring using Quick Extract (Lucigen, #QE09050). Primers for MyD88 genotyping are listed in Table 1 ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from harvested cultures using the Masterpure™ Complete DNA and RNA Kit (Lucigen Corporation, Middleton, Wisconsin). RNA was subsequently purified using the Zymo RNA Clean and Concentrator™ Kit (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: ... rRNAs and other uncapped RNA species were depleted from RNA samples using the Terminator™ 5’-Phosphate-Dependent Exonuclease (Lucigen). Following a standard phenol-chloroform-isoamyl precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... Truncated cDNAs (120-170nt) were size selected from denaturing polyacrylamide gels and gel purified cDNAs were circularized with CircLigase ssDNA ligase (Epicentre). Circularized cDNAs were PCR amplified with forward primer (AATGATACGGCGACCACCGA ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted directly from the sorted nuclei without centrifugation using the MasterPure DNA Extraction kit (Epicentre, Madison, Wisconsin, USA) following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was then stopped with the addition of 190 µl lysis buffer (from MasterPure Yeast DNA Purification Kit (Lucigen)) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments in the range of 30-40 kbp were resolved by gel electrophoresis (2 V cm-1 overnight at 4 °C) and recovered from 1% low melting point agarose gel using GELase 50X buffer and GELase enzyme (Epicentre). Nucleic acid fragments were then ligated to the linearized CopyControl pCC2FOS vector following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Strand-specific libraries were prepared from ribosomal RNA-depleted total RNA using ScriptSeq complete kit for plant leaf (Epicentre; BPL1224) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was extracted from 96-well plates of confluent clones using QuickExtract DNA Extraction Solution (Lucigen Corporation, Middleton, WI, USA) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA from endodontic samples was extracted using the MasterPure Complete DNA and RNA Purification Kit (Epicentre Technologies, Madison, WI, USA) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... at 2 tabs per 50 mL and 100 U of Ready-lyse/ml of culture (Ready-Lyse Lysozyme from Epicentre Lucigen) prior 10 minutes of incubation at room temperature ...
-
bioRxiv - Systems Biology 2023Quote: ... and cloned into the pRDA-550 vector by NEBridge® Golden Gate Assembly Kit (BsmBI-v2) The product from assembly reaction was purified and electroporated into Endura Electrocompetent cells (Lucigen). Transformed bacteria were diluted 1:100 in 2xYT medium containing 100 μg/ml carbenicillin (Sigma ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from the isolates using the MasterPure™ Gram positive DNA extraction kit (Cat. No. MGP04100; Epicentre®). The standard protocol was modified slightly to accommodate for the isolates being Gram negative organisms ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was constructed from the linear pSMART-HCKan vector supplied in the Lucigen CloneSmart kit (Lucigen, Middleton WI, Cat#40708-2) with a single ligation step ...
-
bioRxiv - Neuroscience 2023Quote: 10ug of Trizol-extracted RNA from mouse cortex and striatum was treated with Terminator 5’-Phosphate dependent exonuclease (Lucigen TER51020) according to manufacturer’s protocol. ...
-
bioRxiv - Genetics 2023Quote: DNA was isolated from fixed and sorted cells using the MasterPure DNA purification kit (MC85200, Lucigen, LGC Ltd, Teddington, UK) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR using primers designed to amplify the target region (Forward: CCTTTCTCAGGGCCTCATGTCA; Reverse: GCCTCCAAACAATCAGGGTTGG) was performed with DNA extracted from colonies using QuickExtract (Lucigen). PCR amplified products were screened by restriction digest analysis using the CviAII restriction enzyme (New England Biolabs) ...
-
bioRxiv - Cell Biology 2024Quote: The mouse metabolism library (ref32) was a generous gift from Kivanc Birsoy and was amplified using Endura Electro-Competent cells (Lucigen). Lentivirus was produced for the screen library by the co-transfection of the screen library plasmid with the packaging plasmids psPAX2 and pMD2.G into 293T cells as described above ...
-
bioRxiv - Molecular Biology 2024Quote: Total RNA was extracted from 1 × 107 cells in exponential growth phase using the Masterpure Yeast RNA Purification Kit (Epicentre) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ∼4 pmol of the purified ligated product obtained from an overnight ligation reaction between CS3 and PPP-Lig was digested with 20 U of RNase R (Lucigen) in a 10 μL reaction in the presence of 1X RNase R buffer at 50 °C for 1 h ...
-
bioRxiv - Genomics 2024Quote: ... first-strand cDNAs were synthesized from 1 µg of DNase-treated RNA using the MMLV Reverse Transcriptase Synthesis Kit (Lucigen) protocol with the Oligo(dT)21 primer ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA was prepared from 3 mL of turbid liquid culture with the MasterPureTM Gram Positive DNA Purification Kit (Lucigen). DNA was quantified by using a NanodropTM device (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: Genomic DNA was isolated from untreated and treated cells 72 hours post-treatment using QuickExtract™ DNA Extraction Solution (Lucigen). Both full-length and deleted forms of the target locus were amplified with Q5® High-Fidelity 2X Master Mix (NEB ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from pure yeast colonies with the MasterPure™ Yeast DNA Purification Kit (Epicentre®, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Genomic DNA from isolates exhibiting uracil auxotrophy was purified using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen). The promoter ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We purified PCR products by manually excising them from 2% low-melting-point agarose gels and incubating them at 45 °C for 3 h with GELase (Epicentre).
-
bioRxiv - Cell Biology 2024Quote: ... genomic DNA was extracted from cells by resuspending the pellet in 250 µL of QuickExtract DNA Extraction Solution (Lucigen, QE09050). Samples were heated at 65°C for 6 minutes and 98°C for 2 minutes before amplifying the region surrounding the CRISPR cut site by PCR ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was isolated from clones following overnight culture using a MasterPure™ Gram Positive DNA Purification Kit (Lucigen Corp., USA). The sequencing library was prepared using the Illumina Nextera kit following published methods (22 ...
-
bioRxiv - Developmental Biology 2020Quote: Library preparation was adapted from previous protocols(Flynn et al., 2015; Ingolia et al., 2012) and the ARTseq Ribosome Profiling Kit manual (Epicentre, Illumina). In summary ...
-
bioRxiv - Neuroscience 2020Quote: ... the RNA collected from each cell was reverse transcribed and amplified using T7 linear amplification (Epicentre, MessageBOOSTER kit for cell lysate), cleaned with RNA Cleaner & Concentrator-5 columns (Zymo Research) ...
-
bioRxiv - Bioengineering 2020Quote: ... Genomic DNA was extracted from wild-type and GLUT1-null Caco-2 cells with QuickExtract DNA Extraction Solution (Lucigen, SS000035-D2) and regions of interest were PCR amplified with the designed primers and Taq polymerase (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... at 37°C (1 – 2 h) and 1 μl from PCR reaction aliquots were transformed in electrocompetent E.coli Cloni® 10G cells (Lucigen, USA). Colonies were screened by colony PCR and sequenced.
-
bioRxiv - Immunology 2020Quote: ... cloni® 10G electrocompetent cells (F− mcrA Δ(mrr-hsdRMS-mcrBC) endA1 recA1 Φ80dlacZΔM15 ΔlacX74 araD139 Δ(ara,leu)7697galU galK rpsL nupG λ- tonA (StrR)) were purchased from Lucigen Corporation and were also used for phagemid DNA cloning ...
-
bioRxiv - Molecular Biology 2021Quote: DNA was isolated from HTT Q71-GFP-expressing HEK293 cells through MasterPure™ Complete DNA and RNA Purification Kit (Epicentre®) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... shRNAs were synthesized by in vitro transcription (IVT) from double stranded DNA templates using the AmpliScribeTM T7-flashTM transcription kit (Lucigen, Inc.) and were purified using Direct-Zol TM RNA Miniprep kits (Zymo Research ...
-
bioRxiv - Molecular Biology 2020Quote: ... pombe DNA was extracted from cells grown to log phase at 32°C using MasterPureTM Yeast DNA purification kit (Lucigen/Epicentre). Genomic DNA of Ch16-Tel-DSB ...
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... The first strand of cDNA was synthesized from total RNA (2 μg) using the NxGen M-MuLV Reverse Transcriptase cDNA synthesis kit (Lucigen, UK). The qPCR consisted of a final volume of 15 μl containing 10 ng of cDNA ...
-
bioRxiv - Synthetic Biology 2022Quote: Yeast genomic DNA was prepared from 5 mL stationary phase culture either with the MasterPure™ Yeast DNA Purification Kit (Lucigen) according to the manufacturer guidelines or using the Cetyl Trimethyl Ammonium Bromide (CTAB ...