Labshake search
Citations for Lucigen :
51 - 100 of 287 citations for Hrms Rapid Pcb Screening Calibration Solution Cs0.05 Unlabeled 13C12 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA was isolated (Quick Extract DNA extraction solution, Lucigen), amplified by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... the cell pellet resuspended in 100μL QuickExtract solution (Lucigen #QE09050), transferred to PCR-tubes and incubated in a thermocycler for 15 minutes at 68°C ...
-
bioRxiv - Biochemistry 2020Quote: ... genomic DNA was extracted using Quickextract DNA extraction solution (Lucigen) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was isolated using QuickExtract DNA Extraction Solution (Lucigen). PCR amplified target sequence was heated to 95°C and slowly (2C/s ...
-
bioRxiv - Bioengineering 2020Quote: ... genomic DNA was isolated using QuickExtract DNA Extraction Solution (Epicentre). Two sets of PCR primers were designed ...
-
bioRxiv - Developmental Biology 2022Quote: ... Yolk-sac DNA was extracted (QuickExtract DNA Extraction Solution, Epicentre) and used for genotyping to distinguish heterozygous and homozygous Hand2 conditional allele ...
-
bioRxiv - Molecular Biology 2023Quote: ... gDNA was obtained by using QuickExtract DNA Extraction Solution (Lucigen), where 10000 cells were resuspended in 100 μl PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and cells were lysed using QuickExtract DNA Extraction Solution (Lucigen) following the manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was harvested using QuickExtract DNA Extraction Solution (Lucigen), and gDNA was prepared by heating to 65°C for 10 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were lysed by QuickExtract™ DNA Extraction Solution (Lucigen) to extract genomic DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Microbiology 2023Quote: ... 50 U/μL Ready-Lyse Lysozyme Solution (Lucigen, WI, USA), 2 U/mL Zymolyase (Zymo Research Corporation ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was extracted with QuickExtract DNA extraction solution (EpiCentre) following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was isolated using QuickExtract DNA lysis solution (Epicentre #QE0905T), and genomic DNA flanking the targeted sequence was amplified by PCR (For1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and genomic DNA was extracted using QuickExtract solution (Lucigen, QE0950).
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using QuickExtract genomic DNA extraction solution (Epicentre Biotechnologies) and then screened by PCR amplification of the region of interest ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre#QE09050) and nested PCR was performed using Forward (CATGGAACATCCTTGTGGGGA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies).
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre Biotechnologies). C9ORF72 targeting sgRNA1 ...
-
bioRxiv - Cell Biology 2021Quote: ... DNA was extracted using Quick Extract DNA extraction solution (Epicentre #QE09050) and nested PCR performed ...
-
bioRxiv - Genetics 2022Quote: DNA was extracted 3 dpt using QuickExtract DNA Extraction Solution (Lucigen) and heated at 65□ for 20 min followed by 95□ for 20 min ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA was isolated with QuickExtract™ DNA Extraction Solution (Lucigen) and targeted sequences were amplified by PCR ...
-
bioRxiv - Physiology 2022Quote: ... sorted (eGFP+) cells was extracted using QuickExtract DNA Extraction Solution (Lucigen). EnGen Mutation Detection Kit (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were removed by precipitation with MCP solution (Lucigen, WI, USA) and the supernatant was collected after centrifugation at 17,000 x g for 10 min at 40C ...
-
bioRxiv - Cell Biology 2023Quote: ... and genomic DNA were extracted using QuickExtract DNA Extraction Solution (Epicentre). PCR amplification products of the mutation site were used in restriction fragment length polymorphism assays with the AluI restriction enzyme (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... cells were lysed in a Ready-Lyse lysozyme solution (Epicentre Technologies) according to manufacturer’s instructions and lysates were homogenized through QiaShredder columns (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoid DNA was extracted with QuickExtract™ DNA Extraction Solution (Lucigen) and PCR amplified ...
-
bioRxiv - Genetics 2023Quote: ... and extracted genomic DNA with QuickExtract DNA Extraction Solution (QE09050, Lucigen). PCR on the genomic DNA was performed to identify the presence of chromosomes with or without reporter integration56 ...
-
bioRxiv - Genomics 2024Quote: ... and gDNA was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) for PCR screening of targeting vector integration ...
-
bioRxiv - Cancer Biology 2024Quote: ... and gDNA was extracted by using QuickExtract DNA Extraction solution (Epicentre) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen, USA). Genomic PCR was performed using 100 ng genomic DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... HSPCs were harvested and QuickExtract DNA extraction solution (Epicentre, Madison, WI, USA) was used to collect gDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... HSPCs were harvested and QuickExtract DNA extraction solution (Epicentre, Madison, WI, USA) was used to collect gDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... All antibody solutions were supplemented with 0.4U/µl RNase inhibitors (Lucigen, E0126). For smRNA FISH against endogenous transcripts in wild-type CHO cells ...
-
bioRxiv - Neuroscience 2020Quote: DNA was lysed with 50 μl QuickExtract™ DNA Extraction Solution (Lucigen). Copy numbers were analyzed by quantitative real-time PCR performed in an ABI Prism 7900 HT Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... tail samples were lysed in QuickExtract DNA Extra Solution 2.0 (Lucigen, USA) and PCR reactions were carried out with GoTaq DNA polymerase and with the Primers ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was extracted with QuickExtract™ DNA Extraction Solution (Epicentre, QE09050). Genomic PCR was carried out using Q5® High-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2022Quote: DNA was extracted from cells using the QuickExtract DNA Extraction Solution (Lucigen) and sequencing was performed with 110x coverage using 100 base pair paired end read lengths ...
-
bioRxiv - Biophysics 2021Quote: ... coli strain DH5α was isolated using the QuickExtract DNA extraction solution (Lucigen). The coding sequences of the four autoinducer-2 exporter genes were amplified using the Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... together with 1 1l genomic DNA in QuickExtract DNA Extraction Solution (Lucigen). After droplet generation with the QX200 Droplet generator (Biorad) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA for genotyping was extracted using QuickExtract DNA Extraction Solution (Lucigen, QE09050) from harvested yolk sac tissue if available or else from a micro-dissected nick of the extraembryonic anterior proximal region ...
-
bioRxiv - Genomics 2019Quote: gDNA was extracted by cell lysis using QuickExtract DNA Extraction Solution (Lucigen). From a confluent culture in 96-well plate ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was extracted from one plate using QuickExtract DNA extraction solution (Epicentre) to perform genotyping by PCR using primer pairs specifically recognizing the mutated sequences introduced by the ssODN and a genomic sequence adjacent to the region of integration ...
-
bioRxiv - Immunology 2020Quote: ... and resuspended in 50 µL QuickExtract DNA extraction solution (LuciGen, Middleton, WI). The suspensions were transferred to 96-well PCR plates and incubated at 65 °C for 20 min and then at 98 °C for 5 min using a thermocycler ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genomic DNA was extracted using QuickExtract™ DNA Extraction Solution (Lucigen #QE09050) and 1 μl (qsp ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genotyping was performed by using QuickExtract™ DNA Extraction Solution (Lucigen #QE09050) on a fraction of a clone ...
-
bioRxiv - Genetics 2023Quote: ... and genomic DNA was extracted using QuickExtract DNA Extraction Solution (QE09050; Epicentre) following the protocol recommended in the Alt-R genomic editing detection kit (1075931 ...
-
bioRxiv - Developmental Biology 2023Quote: Tissue from resulting animals was lysed using QuickExtract DNA Extraction Solution (Epicentre) to release the genomic DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted from each clone using QuickExtract DNA solution (Lucigen) according to manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Genomic DNA was isolated with the QuickExtract DNA Extraction Solution (Lucigen, QE09050), and correct PAX6 integration of the appropriate FT construct was confirmed by PCR ...