Labshake search
Citations for Lucigen :
51 - 59 of 59 citations for Ammonium Polyphosphate phase II 02 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Eluted cDNA was moved to a new PCR tube and mixed with CircLigase II (Epicentre) reaction mix containing ...
-
bioRxiv - Biochemistry 2021Quote: ... RNAs were hydrolyzed by addition of 250mM NaOH and the cDNAs were circularized using CircLigase II (Lucigen). The circularized cDNAs were sent to Genomics Core at Scripps Florida for deep sequencing using either single-end or pair-end Illumina NextSeq 500 platform.
-
bioRxiv - Synthetic Biology 2024Quote: The prepared Ds-inserted DNA pools (around 1.5 to 2.5 pmol) were subjected to self-ligation (10μl) by 50 Units of Circligase II (Lucigen) in the circligation buffer supplemented with 2.5mM MnCl2 and 1M Betain for 16 h at 60°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA was later hydrolyzed by 250 mM NaOH and the cDNA was circularized using CircLigase II (Lucigen). The circularized cDNA was shipped to the Scripps La Jolla Genomics Core for final library preparation with Illumina sequencing adaptors and sequenced using single-end sequencing on the Illumina NextSeq 500 platform.
-
bioRxiv - Microbiology 2024Quote: ... and the DNA adaptor was added for cDNA adaptor ligation using CircLigase™ II ssDNA Ligase (CL9021K, Lucigen) as described by the product instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Circular ssDNA substrate was prepared by circularisation of 5’-32P labelled TK-49 using CircLigase II (Lucigen cat#CL9021K), according to manufacturer recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... GU332722.1) or Asia II 1 (GenBank accession no. GU332721.1) was synthesized using the AmpliScribe T7- Flash Transcription Kit (Epicentre, ASF3507), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... tissues from secondary GBM (Grade III (n=44), Grade IV (n=23)) and LGG (grade II, n=42) using MasterPure kit (Epicentre). Raw reads from the RNA-seq data were processed using an in-house pipeline that uses STAR for read alignment ...
-
bioRxiv - Cell Biology 2024Quote: ... An adapter sequence for Illumina sequencing was ligated to the 3’ of the ssDNA on the beads using Cricligase II (Lucigen#CL9025K). A mixture containing 12.5 pmol ssDNA linker (5’-[phospho]CTGTCTCTTATACACATCTCCGAGCCCACGAGACACTCA[dideoxycytidine]-3’ ...