Labshake search
Citations for Lucigen :
701 - 750 of 759 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 11 μL purified CUT&Tag-DNA was used in the reaction (11 μL DNA, 2 μL 10 μM Tn5mC-ReplO1 oligo, 2 μL 10× Ampligase buffer (Lucigen), 2 μL dNTP mix (2.5mM each ...
-
bioRxiv - Molecular Biology 2020Quote: ... Comparable results to commercial RNA extraction kits have been obtained using a 5-min direct detection preparation method of nasopharyngeal samples following 1:1 dilution with the Quick Extract DNA extraction Solution (Lucigen) (6) ...
-
bioRxiv - Microbiology 2022Quote: ... 1 kb regions directly upstream and downstream of the hsdS open reading frame were amplified from genomic DNA of the respective strains and annealed to either side of a chloramphenicol resistance cassette (Tn5 HyperMu transposon, Epicentre) using overlap extension PCR ...
-
bioRxiv - Biochemistry 2022Quote: ... the electroporated T cells were pelleted and gDNA was isolated by adding 50 μL/well QuickExtract DNA extraction solution (Epicentre), followed by incubation at 37 °C for 10 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was then stopped with the addition of 190 µl lysis buffer (from MasterPure Yeast DNA Purification Kit (Lucigen)) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 μL of each required DNA fragment and corresponding bridging oligo were added to 2.5 μL of Ampligase 10X Reaction Buffer (Lucigen, USA), 2.25 μL of 5 M betaine ...
-
bioRxiv - Molecular Biology 2022Quote: Approximately 1e+06 cells were harvested two days post nucleofection and incubated in 200 μL of QuickExtract DNA Extraction Solution (Lucigen) at 65ºC for 15 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragmented gDNA was ended-repaired in 50 μl reaction using the End-It DNA End-Repair Kit (Lucigen, ER81050), incubated at room temperature for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Single clones were expanded and genotyped for the desired knock-in by PCR on genomic DNA extracted with Quickextract solution (Lucigen). Clones showing biallelic knock-ins were expanded and frozen in LN2 at early passages ...
-
bioRxiv - Microbiology 2022Quote: RNA from endodontic samples was extracted using the MasterPure Complete DNA and RNA Purification Kit (Epicentre Technologies, Madison, WI, USA) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... 200µL of the cell suspension was washed twice in PBS and genomic DNA was extracted with Quickextract solution (Lucigen, QE0905T) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: ... We exposed the nucleic acids of each embryo with 5µl of QuickExtract™ DNA Extraction Solution (Lucigen, VWR, Philadelphia, PA), and incubated at 65°C for 15 minutes followed by 2 minutes at 98°C.
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were maintained under regular media exchange until reaching ∼90% confluency when editing was analyzed by extracting genomic DNA using QuickExtract (Lucigen).
-
bioRxiv - Microbiology 2023Quote: ... and purified DNA-free RNA samples were subjected to ribosomal depletion with Ribo-Zero™ Magnetic Kits (Epicentre®, Singapore), all according to manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR using primers designed to amplify the target region (Forward: CCTTTCTCAGGGCCTCATGTCA; Reverse: GCCTCCAAACAATCAGGGTTGG) was performed with DNA extracted from colonies using QuickExtract (Lucigen). PCR amplified products were screened by restriction digest analysis using the CviAII restriction enzyme (New England Biolabs) ...
-
bioRxiv - Genetics 2021Quote: ... and four CS (line 403 subclones 1, S7, S8, and S9) iPSC lines was extracted using quick extract DNA extraction solution (Epicentre #QE09050), amplified by PCR ...
-
bioRxiv - Genomics 2020Quote: ... the ligase-treated DNA was incubated with 2 μl (10 U/μl) of Plasmid-Safe ATP-Dependent DNase (Lucigen; Middleton, WI) in 1x reaction buffer (33 mM Tris-acetate ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 10 serial dilution samples and a non-evolved yLL132a ancestor with the MasterPure Yeast DNA Purification Kit (Epicentre, Madison, WI, USA) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The gDNA was isolated by using a MasterPure™ Complete DNA&RNA Purification Kit (Epicentre®, Illumina®, Madison, Wisconsin, USA) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... clones were genotyped using PCR primers outside of the gRNA targeted region (Table S6) to identify clones homozygous for the mariner deletion (DNA QuickExtract Lucigen #QE09050). Clones passing initial genotyping were then further expanded ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were washed once with DPBS and genomic DNA (gDNA) was extracted with 50 µL/well of Quick-Extract solution (Lucigen, QE09050). Lysates were pipetted up and down thoroughly ...
-
bioRxiv - Developmental Biology 2022Quote: ... shRNAs were synthesized by in vitro transcription (IVT) from double stranded DNA templates using the AmpliScribeTM T7-flashTM transcription kit (Lucigen, Inc.) and were purified using Direct-Zol TM RNA Miniprep kits (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: ... The suspension was spun down at 5,000 x g for 5 minutes and the pellet was resuspended in 100 µl of QuickExtract™ DNA Extraction Solution (Lucigen) and 0.1 µl Ready-Lyse™ Lysozyme solution (Epicentre ...
-
bioRxiv - Neuroscience 2019Quote: ... The genotype of Tet2flox/flox;Cx3Cr1WT/WT and Tet2flox/flox;Cx3Cr1Cre/WT mice was determined by analysis of DNA extracted from the fingers using a QuickExtract™ (Epicentre) and amplified with MyTaq™ Red DNA Polymerase (Bioline) ...
-
bioRxiv - Neuroscience 2019Quote: ... The deletion of the Tet2 gene was determined by analysis of DNA extracted from isolated primary microglia using a QuickExtract™ (Epicentre) and amplified with MyTaq™ Red DNA Polymerase (Bioline).
-
bioRxiv - Genomics 2020Quote: ... Dual extraction of nucleic acid (RNA and DNA) from each pupa was carried out using the MasterPure dual extraction kit (Epicentre, MC85200). Briefly ...
-
bioRxiv - Synthetic Biology 2022Quote: Genomic DNA from overnight saturated cultures of isogenic bacterial clones was prepared using the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen) according to the manufacturer’s guidelines and sequenced at the Microbial Genome Sequencing Center (MiGS ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Crude genomic DNA was generated by incubating yeast isolates at 95°C in 50 μL of 20 mM NaOH for 10 minutes or the MasterPure™ Yeast DNA Purification Kit (Lucigen). PCR Tag analysis was performed either by adding 1.8 μL of yeast lysate used as template DNA to 6.25 μL of 2X GoTaq® Green Master Mix (Promega) ...
-
bioRxiv - Plant Biology 2023Quote: ... Thirty thousand cells of each clone were added to 100 μL of Quick Extract™ DNA Extraction Solution (Lucigen, Wisconsin, USA). DNA was extracted by heat treatment (65°C for 6 min and 98°C for 2 min) ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA was isolated from yeast and contaminating DNA was depleted using the MasterPure Yeast RNA Purification Kit (Epicentre, Madison, WI) protocol with minor changes as previously described (Carrocci et al. ...
-
bioRxiv - Biochemistry 2023Quote: Fosmids from each hit were isolated by BioS&T (Quebec, Canada) or using the FosmidMAX™ DNA Purification Kit (Lucigen Corporation). Isolated fosmids were prepared for Illumina sequencing using the plexWell™ 96 kit (seqWell ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA was repaired with Blunt-end ending 3′ overhang using End-It DNA End-Repair kit in 25 µl volume (Epicentre; ER81050), and 3′-A overhang was added with Klenow fragment (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... the amplified DNA was cloned into the pETite N-His vector (Expresso™ T7 cloning and expression system, Lucigen, # 49001-1), resulting in constructs with an N-terminal 6x His tag ...
-
bioRxiv - Microbiology 2020Quote: ... and a mix of 600 µl of tissue and cell lysis solution and 2 µl Proteinase K from the MasterPure Complete DNA and RNA Purification Kit (Epicentre-Lucigen, Middleton, WI) was added to each sample tube ...
-
bioRxiv - Biochemistry 2022Quote: ... Clones with the best response to TMP were expanded and lysed for gDNA extraction and purification using the QuickExtract DNA extraction solution (Lucigen, Middleton, WI). Genomic ecDHFR was amplified (forward ...
-
bioRxiv - Molecular Biology 2020Quote: The >200nt RNA fraction was ribo-depleted using non-overlapping DNA oligonucleotides that are complementary to rRNA 18s and 28s followed by digestion with Hybridase™ Thermostable RNaseH (Lucigen #H39500), as previously described (79) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 22 Alanine production plasmids were constructed using codon optimized (Codon Optimization Tool from the IDT) synthetic DNA and the pSMART-HCKan vector (Lucigen, Middleton, WI). Plasmids were assembled using NEBuilder® HiFi DNA Assembly Master Mix following manufacturer’s protocol (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The swabs were each placed in 1.5 mL Eppendorf tube containing 200 ul of QuickExtract DNA Extraction Solution (QE buffer, Lucigen LLC, Madison, WI). Each tube was vortexed and stored until extraction.
-
bioRxiv - Genomics 2022Quote: ... from at least two freshly starved 9 cm plates of the appropriate worm strain using the MasterPure Complete DNA and RNA Purification kit (Lucigen; cat. #MC85200), following manufacturer protocols ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA from edited and unedited HSPC samples was harvested 48h post-editing using QuickExtract DNA Extraction Solution according to manufacturer’s recommendations (Lucigen Corp., Teddington, UK) and diluted to 4.55 ng/uL in IDTE pH 8.0 (IDT ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was randomly sheared through a syringe needle and was end-repaired and cloned into pWEB::TNC (Epicentre Technologies, Madison, WI), followed by packaging into MaxPlax lambda packaging extracts ...
-
bioRxiv - Genomics 2023Quote: ... About 20,000 prepared barcode beads were resuspended in 40 μl enzyme buffer (1 U/μl Fast-Link DNA Ligase (Lucigen, E0077-2-D3), 20% End-It Enzyme Mix (Lucigen ...
-
bioRxiv - Molecular Biology 2023Quote: ... primer sets were screened against a synthetic TSV RNA target in vitro transcribed from gBlock™ DNA (IDT, Table S1) using the Ampliscribe T7-Flash Transcription kit (Lucigen Corporation) and purified using the RNA Clean and Concentrator kit (Zymo Research ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was discarded and the pellet resuspended in 300 μl of lysis solution and 1 μl of RNase A from the MasterPure™ Complete DNA and RNA Purification Kit (Lucigen, US). The kit protocol was followed ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR screening of the colonies was performed using genotyping oligos listed in Supplementary Table 1 using Quick Extract DNA Extraction Solution (Lucigen Catalog Number: QE09050) according to manufacturer’s protocol in a PCR machine and DreamTaq Green Polymerase (Thermo Fisher Scientific Catalog Number ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA from fungal mycelium grown on SDA plates was extracted according to the manufacturer’s instructions (Epicentre, Madison, WI, USA, Cat. No. MC85200). Complete ITS1-5.8S-ITS2 (ITS ...
-
bioRxiv - Biochemistry 2020Quote: ... pNT-15 was constructed using NEB HiFi DNA Assembly with a gBlock® from IDT (Coralville, IA) and cloning vector pSMART-HCKan (Lucigen, #40704-2). All PCR reactions were performed with Q5® Hot-Start High Fidelity Master Mix (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... and a mix of 600 µl of tissue and cell lysis solution and 2 µl Proteinase K from the MasterPure Complete DNA and RNA Purification Kit (Epicentre-Lucigen, Middleton, WI) was added to each sample tube ...
-
bioRxiv - Microbiology 2021Quote: ... eDNA was purified from the samples by removing the proteins and RNA using MasterPure Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), and the DNA concentration was measured using NanoVue Plus (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genomic DNA from the whole mosquito was isolated and purified using the MasterPure™ Gram Positive DNA Purification Kit following the manufacturer’s instructions (Epicentre Biotechnologies, Madison, USA). During DNA extraction ...