Labshake search
Citations for Lucigen :
501 - 550 of 759 citations for DNA Polymerase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and resuspended in 50 µL QuickExtract DNA extraction solution (LuciGen, Middleton, WI). The suspensions were transferred to 96-well PCR plates and incubated at 65 °C for 20 min and then at 98 °C for 5 min using a thermocycler ...
-
bioRxiv - Developmental Biology 2022Quote: ... and genomic DNA was isolated using a Quick-Extract Buffer (Lucigen GE09050). Successful heterozygous deletion lines were identified using the PCR primers CCCCCACCCATCAGTCATTC and GGTTGTGCCTCATAGTGCCT and Q5 Polymerase (NEB M0491S) ...
-
bioRxiv - Microbiology 2022Quote: ... theta was end-repaired using End-IT DNA End-Repair kit (Lucigen) in a 50 μL reaction consisting of 2 μL End-It Enz mix ...
-
bioRxiv - Molecular Biology 2022Quote: ... Genotyping was performed by using QuickExtract™ DNA Extraction Solution (Lucigen #QE09050) on a fraction of a clone ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted three days after transfection with QuickExtract (QE) (Lucigen). Cells were washed once with PBS and 50 μL QE was added per well of a 96-well plate ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA contamination was depleted using Baseline-Zero DNase (Lucigen/Epicentre, #DB0715K) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA contamination was depleted using Baseline-Zero DNase (Lucigen/Epicentre, #DB0715K) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: Tissue from resulting animals was lysed using QuickExtract DNA Extraction Solution (Epicentre) to release the genomic DNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... the genomic DNA was treated with Plasmid-Safe ATP-dependent DNase (Lucigen) at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Extraction of template genomic DNA was performed by using QuickExtract (Epicentre QE0905T). 2 μl of genomic DNA extract solution was used to PCR amplify the genomic locus of interest (RFX2 ...
-
bioRxiv - Neuroscience 2023Quote: DNA was extracted from 96-well plates of cells using QuickExtract (Epicentre) by incubation at 65°C for 6 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... Ampligase DNA Ligase and 10X Reaction Buffer were purchased from Lucigen (A3202K). 2X GoTaq G2 Hot Start Colorless Master Mix was purchased from Promega (9IM743) ...
-
Measuring carbohydrate recognition profile of lectins on live cells using liquid glycan array (LiGA)bioRxiv - Biochemistry 2023Quote: ... The resulting ligated DNA was transformed into electrocompetent cells E.coli SS320 (Lucigen) and propagated overnight.
-
bioRxiv - Molecular Biology 2021Quote: ... the genomic DNA of edited cells were extracted using Quick Extraction kit (Lucigen). Target sites carrying gene-edited sequences were PCR amplified using gene-specific primers (Additional file 2 ...
-
bioRxiv - Genomics 2020Quote: ... media was aspirated and 50-100 μL QuickExtract™ DNA Extraction Solution (Lucigen) were added to each well ...
-
bioRxiv - Genomics 2019Quote: ... The ligated DNA sample was used to transform electrocompetent E.coli cells (EPI300, Epicentre), using 1 µl of ligated DNA solution per transformation ...
-
bioRxiv - Microbiology 2020Quote: Saliva samples were treated with the Quick ExtractTM DNA Extraction Solution (QE, Lucigen) by mixing 50 μl of saliva with 50 μl of the QE reagent and heating for 5 minutes at 95°C ...
-
bioRxiv - Microbiology 2021Quote: ... Linear chromosomal DNA was reduced by Plasmid-Safe ATP-Dependent DNase (Epicentre, USA) treatment for 24 hours at 37°C according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: DNA was extracted from cells using Quick Extract (Lucigen, Wisconsin, USA, Cat #QE09050) and amplified using primer pairs listed in Table S4 designed to amplify 66-80 base pair segments containing the predicted cut site for each of our gRNAs listed in Table of gRNAs ...
-
bioRxiv - Bioengineering 2022Quote: ... The first passage after electroporation genomic DNA was isolated using QuickExtract™ (Lucigen), following manufacturer protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were re-suspended in 20 μl of DNA Extraction Solution (Lucigen), and incubated at 68°C for 6 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Sanger sequencing was then extracted using QuickExtract™ DNA Extraction Solution (Lucigen). The PDX1 knockout line was generated in an analogous way.
-
bioRxiv - Molecular Biology 2020Quote: Harvested cells were lysed using QuickExtract DNA Extraction Solution (Lucigen, Cat. No. QE09050) following manufacturers protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... the genomic DNA of each clone was extracted by using QuickExtract solution (Epicentre) and PCR was carried out ...
-
bioRxiv - Microbiology 2020Quote: ... was isolated using the MasterPure DNA purification kit (MCD85201 Epicentre, Middleton, WI, USA). For constructing nanB-deletion mutants ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA-DNA hybrids were specifically digested with Hybridase Thermostable RNase H (Epicentre) at 45 °C for 1 hour ...
-
bioRxiv - Genetics 2019Quote: ... The cell pellet was agitated in 100 μL of QuickExtract DNA Solution (Lucigen) to disrupt the pellet and placed in a thermocycler for 15 minutes at 68°C followed by 10 minutes at 95°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The remaining DNA was depleted with 2 U of Baseline-ZERO DNase (Epicentre) and ribosomal RNA was depleted using the Ribo-Zero Plant rRNA removal kit (Epicentre) ...
-
bioRxiv - Microbiology 2020Quote: ... or Epicenter MasterPure Complete DNA and RNA Purification Kit (Lucigen, Madison, WI, USA) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the MasterPure™ Gram Positive DNA Purification Kit (Epicentre, Madison, WI, USA), for PacBio sequencing ...
-
bioRxiv - Genomics 2021Quote: ... and then were resuspended in 385 µL DNA Quick Extract (Lucigen cat# QE09050) and transferred to a 1.5 mL tube ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was treated with 0.2 units/ul Plasmid-Safe ATP-Dependent DNase (Epicentre) for 5 days at 37 degrees ...
-
bioRxiv - Plant Biology 2022Quote: ... Contaminating DNA was removed from total RNA samples with Baseline-ZERO DNase (Epicentre), whereas ribosomal RNA was removed using a Ribo-Zero rRNA Depletion Kit (Epicentre) ...
-
bioRxiv - Neuroscience 2023Quote: ... the genomic DNA was extracted from single clones using QuickExtract solution (Lucigen, QE090500) and HDR was verified by locus specific PCR using DreamTaq DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were sorted in 5 μl of QuickExtract DNA Extraction Kit (Epicentre, USA) in 96-well format.
-
bioRxiv - Cell Biology 2023Quote: ... and residual linear DNA was degraded by Plasmid-Safe ATP-dependent DNase (Lucigen). In vitro cleavage reactions were performed with 250 ng of Plasmid-Safe-treated circularized DNA ...
-
bioRxiv - Microbiology 2023Quote: ... Chromosomal DNA was extracted from the pools using Ready-Lyse Lysozyme (Epicentre Lucigen) and DNAzol (ThermoFischer ...
-
bioRxiv - Microbiology 2023Quote: ... Chromosomal DNA was extracted from the pools using Ready-Lyse Lysozyme (Epicentre Lucigen) and DNAzol (ThermoFischer ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation was performed using NxSeq AmpFREE Low DNA Fragment Library Kits (Lucigen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... blunt-end DNA was prepared using the End-It End Repair Kit (Epicentre), “A” bases were added using Klenow fragment (NEB) ...
-
bioRxiv - Evolutionary Biology 2023Quote: RNA was extracted using the MasterPure Complete DNA and RNA Purification Kit (Lucigen). Samples consisted of pools of two individuals per line resulting in 16 flies per each sex- ...
-
bioRxiv - Molecular Biology 2023Quote: Remaining linear DNA molecules were digested with Plasmid-Safe ATP-dependent exonuclease (Epicentre) continuously at 37°C for 120 h ...
-
bioRxiv - Genetics 2021Quote: ... and libraries were constructed using the NxSeq AmpFREE low DNA Library Kit by Lucigen. Bisulfite conversion was done using the EZ-96 DNA Methylation-GoldTM MagPrep kit (D5042 ...
-
bioRxiv - Genomics 2019Quote: ... Remaining linear DNA was removed with Plasmid-Safe-ATP-Dependent DNAse (Epicentre, Madison WI). Guide RNAs were designed using chopchop (http://chopchop.cbu.uib.no/index.php) ...
-
bioRxiv - Genetics 2020Quote: Cells were lysed in plate format in 50µL QuickExtract DNA Extraction Solution (Lucigen QE09050). Crude lysate was then incubated at 65°C for 20 minutes and 95°C for 20 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... Biopsies were transferred to 10μL of Epicenter DNA extraction buffer (Lucigen, Palo Alto, CA) and lysed as described above ...
-
bioRxiv - Bioengineering 2020Quote: ... cell pellets were resuspended in a QuickExtract DNA extraction solution (Lucigen, Middleton, WI, USA), incubated at 65°C for 10 mins ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3) Remaining linear DNA was removed by exonuclease (Plasmid-Safe ATP-dependent DNase, Epicentre), assisted by rare-cutting endonuclease MssI (only support Homo sapiens ...
-
bioRxiv - Genomics 2022Quote: ... Sonicated gDNA ends were repaired using End-It™ DNA End-Repair Kit (Epicentre) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... which were washed with PBS and resuspended in QuickExtract DNA Extraction Solution (Epicentre, QE09050). Cells were incubated at 68 °C for 15 min and 95 °C for 8 min and the integrated synthetic VL-Ck-2A-VH antibody region was PCR-amplified with flanking primers 5’-CATGTGCCTTTTCAGTGCTTTCTC-3’ and 5’-CTAGATGCCTTTCTCCCTTGACTC-3’ that were specific for the 5’ and 3’ homology arms ...