Labshake search
Citations for Agilent :
551 - 600 of 1345 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Gene-specific probes were generated by random priming in the presence of ATP [α32P] using the Prime-It II Random Primer Labeling Kit (Agilent, 300385) using PCR generated DNA template produced from gDNA isolated from a wild type S.pombe strain (YP71 ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA was next converted to cDNA by using a polydT primer and following the AffinityScript Multiple Temperature cDNA Synthesis kit instructions (Agilent Technologies). In order to quantify the HEV genome ...
-
bioRxiv - Biophysics 2021Quote: ... and E217A were cloned with primers IF733 and IF734 using QuikChange Lightning Multi Site-Directed Mutagenesis Kit to generate plasmid pIF585 (Agilent #210516). RAD51(K133R ...
-
bioRxiv - Biophysics 2020Quote: ... The desired base pairs coding for Cys were introduced using overlapping primers with the QuikChange II site-directed mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Immunology 2022Quote: ... A second reverse transcription reaction was performed with MARS-seq RT2 primer and the Affinity Script cDNA Synthesis Kit (Agilent Technologies) followed by 1.5X AMPure XP bead cleanup ...
-
bioRxiv - Biochemistry 2020Quote: ... SDM was carried out with appropriate primers (Table 4) using QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) according to manufacturer’s instruction.
-
bioRxiv - Biophysics 2019Quote: ... The fusion constructs were generated by deletion of amino acids from the 5-HT3A-ICD using appropriate partially overlapping primers with the QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing (GENEWIZ ...
-
bioRxiv - Microbiology 2019Quote: ... 39) with primers WNTP0548 (GAGTTATTGGGGGCTTGAAGT) and WNTP0549 (AATCCTTTTTCGATGTTGATAATTAAGTCG) and subjected to random mutagenesis using GeneMorph II EZClone Mutagenesis kit (Agilent Technologies) per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... qPCR was performed with 5 μl of 20x-diluted cDNA and a primer concentration of 1 μM in a 20 μl reaction with Brilliant III Ultra-Fast SYBR GREEN Master Mix (Agilent, www.agilent.com) with a BioRad CFX Connect thermocycler (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... were generated with site-directed mutagenesis using custom-designed primers (Eurofins Genomics) and PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies). Truncated NALCN ...
-
bioRxiv - Neuroscience 2022Quote: ... and L454A (or MA4-WRLAAA) were generated using appropriate primers and the QuikChange II XL Site-Directed Mutagenesis kit (Agilent Technologies) and were confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... mutations G to C at positions 445 and 457 were introduced into DCP2 in plasmid pQZ145 (Zeidan et al. 2018) using primers AKV005/AKV006 and the Quick-change Site-Directed mutagenesis kit (Agilent, 200519), generating plasmid pAV008 containing dcp2-E149Q,E153Q ...
-
bioRxiv - Immunology 2023Quote: ... The predicted CLIPA8 cleavage site 63IMLR66 was replaced by IEGR [26] using the CLIPA8mutag primer and the QuikChange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) to create plasmid pOET3-CLIPA8Xa-V5-His (Table S3) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μL of SST1-F/R PCR product was cloned into pSC-A-amp/kan vector using Strataclone™ PCR Cloning Kit (Agilent, Cat.#240205) following manufacturer’s instructions and transformed into E ...
-
bioRxiv - Neuroscience 2019Quote: ... After one last wash with DPBS for 5 minutes at RT the coverslips were imbedded in fluorescent mounting medium (DAKO #S3023). Primary antibodies that were used ...
-
bioRxiv - Neuroscience 2021Quote: ... the slides were counterstained with DAPI for 30 sec at RT and mounted using Dako fluorescent mounting medium (Agilent Technologies, USA). The dyes used for signal detection were Opal Dye 520 and Opal Dye 570 (Akoya Biosciences ...
-
bioRxiv - Cell Biology 2023Quote: ... Probes (available in Table S7) were labeled with 32P-dCTP using the Prime-It RT random labeling kit (Agilent, catalog #300329) and hybridized to the membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed and incubated with HRP-conjugated secondary antibodies for 1 h at RT (Goat-anti-Rabbit-HRP, Goat-anti-Mouse-HRP, both Dako Denmark). Marker lanes were incubated with Streptavidin-biotinylated-HRP (GE Healthcare) ...
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Neuroscience 2024Quote: ... Sections were washed 5 x 15 min in PBST at RT and slides were mounted in DAKO fluorescent mounting medium (Agilent Technologies). EdU staining was performed on sections from larvae that received an EdU pulse ...
-
bioRxiv - Genetics 2021Quote: ... To reproduce the A-variant the following primers were used for SDM by site directed mutagenesis using QuickChange II site directed mutagenesis kit (Agilent Technologies, UK) using the following primers ...
-
bioRxiv - Developmental Biology 2020Quote: ... one μg of total RNA from LV was used to synthetize cDNAs using oligo(dT) primers and affinity script reverse transcriptase (Agilent technologies France). Real-time quantitative PCR analyses were performed using the Light Cycler LC 1.5 (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation ...
-
bioRxiv - Developmental Biology 2023Quote: ... one µg of total RNA was used to synthetize cDNAs using oligo(dT) primers and affinity script reverse transcriptase (Agilent technologies France). Real-time quantitative PCR analyses were performed using the Light Cycler LC 1.5 (Roche ...
-
bioRxiv - Cancer Biology 2021Quote: ... qRT-PCR was performed as previously described (Sodi et al., 2015) using Brilliant II qRT-PCR Master Mix 2 Kit (Stratagene, San Diego, CA, USA) using Applied Biosystems 7500 machine. ...
-
bioRxiv - Cell Biology 2019Quote: ... on an Mx3000P real-time PCR machine (Agilent Technologies Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and AriaMx real-time PCR system (Agilent Technologies, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5 ml plastic tubes (PCR tubes, Stratagene, Cedar Creek, TX). Samples were rapidly heated to 37°C directly in cuvettes pre-warmed to 37°C in a Pelltier cell changer (took 30 sec) ...
-
bioRxiv - Genomics 2022Quote: Purified PCR product was measured using a D5000 ScreenTape (Agilent). cDNA samples were diluted to 600 pg/μL and 2 μL of this was used for tagmentation with Nextera XT kit.
-
bioRxiv - Molecular Biology 2021Quote: ... or a Stratagene Mx3005P Real-Time PCR system (Agilent Technologies) with LightCycler® 480 SYBR Green I Master Mix (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR conditions using high-fidelity Pfu DNA polymerase (Agilent Technologies) were as follows ...
-
bioRxiv - Genomics 2020Quote: ... The molarity of PCR amplified libraries was measured by Agilent Tapestation High Sensitivity DNA screentapes and all samples were pooled at equal molarity ...
-
bioRxiv - Synthetic Biology 2020Quote: The PCR-based Quick change site directed mutagenesis kit (Agilent) was used to remove N-glycosylation sites from the hIL-22 ORF by mutating the Asn residue of the Asn-X-Ser/Thr consensus sequence to Gln (Supplementary Table 4) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Barcoded PCR products were analyzed on a 2200 TapeStation (Agilent) before and after 2 rounds of 0.6x SPRI bead purification to exclude primer dimers ...
-
bioRxiv - Genomics 2019Quote: PCR products were cloned into a linearised pBlueScript KS (Agilent) vector by blunt-end ligation ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product was purified and size controlled by Agilent Technologies 2100 Bioanalyzer (High Sensitivity DNA Chip) ...
-
bioRxiv - Biochemistry 2021Quote: ... Site-directed mutations were introduced by PCR (Quikchange, Agilent Technologies). CodB-GFP fusions were expressed in E ...
-
bioRxiv - Bioengineering 2019Quote: ... PCR was performed with Herculase II Fusion DNA polymerase (Agilent Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... Polymerase chain reaction (PCR) reagents and kits were from Agilent and Himedia ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR enrichment was performed using the PfuTurbo Cx hotstart (Agilent), PfuTurbo Cx hotstart buffer (Agilent) ...
-
bioRxiv - Biochemistry 2022Quote: ... SPTLC1 variants were generated using mutagenesis PCR (QuikChange Lightning, Agilent) in pDONR221-SPTLC1 and flipped into pcDNA5-pDEST-3xFLAG destination vector.
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was performed with a Mx3000P (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: Quantitative PCR was performed on a Mx3000P instrument (Agilent Technologies) using Brilliant II SYBR Green qPCR Mastermix (Agilent Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... app8 was amplified by error prone PCR (GeneMorph II, Agilent) using primers AW_Sac6_mut_F and AW_Sac6_mut_R and cloned back into pAW258 using Gibson assembly ...
-
bioRxiv - Systems Biology 2020Quote: ... The cleaned PCR products were transferred by robot (Bravo, Agilent) to a 384 well plate and an equal volume of each of them pooled by Echo (Echo550 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were cloned into a pBluescript SK (+) vector (Stratagene). Ten clones were randomly chosen and sequenced (Genome Québec).
-
bioRxiv - Microbiology 2020Quote: ... The quantitative PCR was performed on Stratagene Mx3005P (Agilent Technologies) with the following program ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA were PCR amplified with herculase polymerase (Agilent Technologies, USA) or CloneAmp HiFi PCR Premix (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... All PCR were done using high-fidelity DNA polymerases (Agilent). Primers used in this study are listed in Table S2 ...
-
bioRxiv - Microbiology 2020Quote: ... Polymerase chain reaction (PCR) was performed using Pfu Turbo (Stratagene).