Labshake search
Citations for Agilent :
301 - 350 of 987 citations for TIM 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... MAQCA is the Quantitative PCR Human Reference Total RNA (#750500, Agilent technologies), extracted from cell lines representing different human tissues ...
-
bioRxiv - Immunology 2020Quote: ... Monoclonal mouse IgG1 anti-human CD32 (clone KB61) was purchased from Dako, Santa Clara ...
-
bioRxiv - Immunology 2020Quote: ... using Agilent Human miRNA 8*60 K V21.0 microarray (Agilent Technologies, USA). The NCBI BioProject database accession number is PRJNA600674 ...
-
bioRxiv - Immunology 2020Quote: ... using Agilent Human miRNA 8*60 K V21.0 microarray (Agilent Technologies, USA). The Gene Expression Omnibus accession number is PRJNA600674 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human ARRB2 cDNA was cloned into pCMV-3Tag-8 (Agilent Technologies). The plasmid contains three copies of a FLAG epitope tag fused in-frame to the 3’ end of the ARRB2 cDNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Whole-exome sequencing was performed using SureSelect Human All Exon V7 (Agilent) according to manufacturer’s protocol and sequenced on an Illumina NextSeq 500 (paired-end 150 bp reads) ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated with primary antibodies against human CD31 (1:50, JC70A, Dako), PDGFRβ (1:100 ...
-
bioRxiv - Genetics 2023Quote: ... Microdeletions were identified by array-CGH (Human Sureprint 2×105K, Agilent technologies) and confirmed with semiquantitative PCR ...
-
bioRxiv - Physiology 2024Quote: ... Hybridization to SurePrint G3 Human Gene Expression 8×60K Microarrays (Agilent Technologies) was performed with the Gene Expression Hybridization Kit (Agilent Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary antibody was mouse anti-human Aβ (Dako #M0872; 1:400) and the secondary antibody was Vectastain ABC kit anti-mouse secondary antibody (Vector Laboratories #PK-4002 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then immunostained using an anti-human Ki-67 (Dako # M724001) antibody and nuclear DNA was stained using 4,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: 10 ul of RNA combined with 25 ng Human Universal Reference RNA (Agilent) was purified by PureBeads (Roche Sequencing) ...
-
bioRxiv - Genomics 2020Quote: ... Slides were additionally co-stained with rabbit anti-human vWF polyclonal antibody (Dako) at a dilution of 1:100 overnight at 4°C followed by donkey Alexa488-conjugated anti-rabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD68 (Dako, clone PG-M1, 1:750, pH 6 retrieval), mouse anti-human CD20 (Dako ...
-
bioRxiv - Cancer Biology 2020Quote: ... the following antibodies were used: anti-human Ki-67 (DAKO, clone Ki-67), anti-oestrogen receptor alpha (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Exome capture was performed with the SureSelect Human All Exon v6 kit (Agilent) and sequenced on the Illumina HiSeq platform ...
-
bioRxiv - Immunology 2021Quote: ... The specific primary antibody polyclonal rabbit anti-human CD3 (Dako, #A4052, California, USA) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein-coding genes were captured using SureSelectXT Human All Exon V5 probes (Agilent) and sequenced on Illumina HiSeq 4000 using 100bp paired end read protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... these slides were incubated with rabbit anti-human PGP 9.5 (DAKO 1:100) overnight at 4°C to mark the nerve fibers ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary anti-human Ab (Dako) for 1□h at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... microglial lysosomes were stained using CD68 (mouse anti-human monoclonal primary antibody, Dako M0876,1:100 ...
-
bioRxiv - Immunology 2020Quote: ... followed by incubation with polyclonal antibodies against human kappa light chains (Dako, A0192) and by HRP-conjugated protein A (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-human CD20 clone L26 Dako Omnis (Agilent, Santa Clara, CA, USA). The secondary antibody used in this study included HRP Goat anti-Rabbit IgG (H&L ...
-
bioRxiv - Cancer Biology 2022Quote: ... Subsequently libraries were hybridized to specific SureSelect XT Human capture libraries (Agilent Technologies) and sequenced in paired-end mode (2×75 bp ...
-
bioRxiv - Immunology 2020Quote: ... and α-CD19 (clone HD37; Dako [α-human]; clone SJ25-C1 [α-mouse]) were added to 5 × 108 cells for 5 min at 37° ...
-
bioRxiv - Pathology 2020Quote: ... A polyclonal rabbit anti-human CD3 antibody (1:200; Agilent Technologies Inc, CA) was applied for 15 min and used with Leica Polymer Refine Detection kit to complete the staining.
-
bioRxiv - Pathology 2021Quote: ... Whole human genome oligonucleotide microarray (44K oligonucleotide DNA microarray, Agilent Technologies, Tokyo, Japan) was used for microarray experiments ...
-
bioRxiv - Genomics 2019Quote: ... and mouse monoclonal anti-human CD8 (DAKO, clone C8/144B, dilution 1:25) at 1 hour RT ...
-
bioRxiv - Physiology 2021Quote: ... Anti-human CD68 (mouse monoclonal IgG3, clone PG-M1, Dako, dilution 1/100) and anti-human IL-1β (rabbit polyclonal antibody ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing were generated using SureSelect Human All Exon 50Mb Kit (Agilent Technologies) coupled with Illumina HiSeq sequencing system (Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary anti-human Ab (Dako) for 1□h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Sequencing libraries were generated using Agilent SureSelect Human All Exon kit (Agilent Technologies) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample (experimental details provided in the Supplementary Data).
-
bioRxiv - Microbiology 2022Quote: ... Sections were stained with mouse anti human CMV (Dako, Agilent technologies, Glostrup, Denmark) primary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... gene expression analysis was carried out by Agilent Whole Human 44K Genome Oligo Array (G4112A, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: Primary rat neurons or human i3Neurons were plated on Seahorse XFp plates (Agilent) at a density of 40,000 cells/well ...
-
bioRxiv - Genomics 2022Quote: ... and libraries were enriched with exome baits (Agilent SureSelect Human All Exon V6). Separate tumor sections were placed on 10X Visium arrays (slide serial number ...
-
bioRxiv - Immunology 2023Quote: ... and as secondary antibody we used anti-human IgG HRP antibody (Agilent P0214) diluted 1:8,000 in PBS + 1% SM ...
-
bioRxiv - Genetics 2024Quote: ... A SureSelect Human All Exon V6+UTR r2 core design (91 Mb, Agilent) was used for exon capture ...
-
bioRxiv - Genomics 2024Quote: ... spiked into a background of human reference RNA (Agilent Technologies, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... human stem cell-derived ECs were cultured in the xCELLigence RTCA SP (Agilent) device and treated with cARLA or control medium exactly as described above ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 x 150-mm Zorbax SB-Aq column (Agilent, Santa Clara, CA). A coupled DAD-3000RS diode array detector (Dionex) ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...