Labshake search
Citations for Agilent :
201 - 250 of 987 citations for TIM 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-human tau was from Dako (1:8000, A0024). Other tau antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Immunohistochemistry (IHC) for human CD45 antibodies (IR75161-2, Agilent Technologies) was performed on FFPE blocks of engrafted tumors to identify cases of lymphomagenesis ...
-
bioRxiv - Immunology 2022Quote: ... the plates were incubated with either anti-human-HRP (Dako), anti-rat-HRP (Invitrogen) ...
-
bioRxiv - Cancer Biology 2019Quote: ... (30) using the SureSelectXT Human All Exon 50 Mb (Agilent) bait set ...
-
bioRxiv - Cancer Biology 2020Quote: ... monoclonal mouse anti-human alpha smooth muscle actin (M0851, Dako), monoclonal mouse anti-human CD68 (M0814 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 1:400 diluted Rabbit anti-human calcitonin (Dako, Denmark) at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Samples were analyzed against the Stratagene Universal Human Reference (Agilent). Raw fluorescence intensities were quantified and normalized (Lowess normalization ...
-
bioRxiv - Cell Biology 2021Quote: ... IgA heavy chain (rabbit anti-human, Dako, A0262 1:1000) and secretory component/pIgR (goat anti-human ...
-
bioRxiv - Neuroscience 2021Quote: ... Anti-SMA (1:67, human, Dako, M0851, Santa Clara, CA) with secondary donkey anti-mouse Cy3 (1:200 ...
-
bioRxiv - Immunology 2020Quote: ... 0.006 g/L polyclonal rabbit anti-human CD3 antibody (Dako A0452 ...
-
bioRxiv - Cancer Biology 2020Quote: ... whole Human Genome 44 K arrays (Agilent Technologies, product G4112A) were used for stroma and epithelial expression profiles ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal CD31 anti-human clone JC70A (M0823, Agilent Dako, Santa Clara ...
-
bioRxiv - Genetics 2022Quote: ... including A sample (Universal Human Reference RNA, Agilent Technologies, Inc.) and B sample (Human Brain Reference RNA ...
-
bioRxiv - Immunology 2023Quote: ... stimulation with rabbit anti-human IgE (Dako, Carpinteria, CA, USA) and fMLP (N-Formylmethionine-leucyl-phenylalanine ...
-
bioRxiv - Immunology 2023Quote: ... and mouse anti-human CD68 (Dako #M0814, 1:400 dilution), following by the secondary antibody incubation and chromogenic detection with DISCOVERY Purple and Yellow kits (Ventana-Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2024Quote: ... The Agilent SureSelect Human All Exon v6 kit (Agilent Technologies) was used for whole exome sequencing ...
-
bioRxiv - Genetics 2024Quote: ... The exomes of the subjects were captured by Agilent SureSelect Human All Exon V6 Enrichment kits (Agilent, CA, USA) and then sequenced on a HiSeq X-TEN system (Illumina ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Genomics 2021Quote: ... Lysates and positive technical controls (Human Universal Reference RNA - uhrRNA Agilent Cat# 740000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-human prealbumin/TTR (1:1000, 2.0 g L−1, Dako), anti-DNAJB11/ERdj3 (1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse anti-human HLA-DRα mAb (clone, TAL. 1B5; Dako Cytomation), mouse anti-human CD163 mAb (clone ...
-
bioRxiv - Cancer Biology 2019Quote: Whole Human Genome Microarray Kit 4×44K (Agilent, Cat. No. G4112F) was used to detect mRNA expression levels in cells transfected with control and miR-101-3p transfected HCT116 cells ...
-
bioRxiv - Immunology 2019Quote: ... Serial 10-fold dilutions of mouse or human reference RNA (Agilent) were run in duplicate for each PCR run.
-
bioRxiv - Genetics 2020Quote: ... SureSelectXT Human All Exon V6 +UTR (Agilent Technologies, Santa Clara, CA) was then used to perform exome capture and library preparations The library were then sequenced using a NovaSeq 6000 System (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... QPCR Universal Human Total Reference RNA (UHR) (Agilent, Cat no: 750500) was included in all batches to assess batch effect.
-
bioRxiv - Cancer Biology 2021Quote: ... Exomes were sequenced using the AllExon Human SureSelect v7 Kit (Agilent).
-
bioRxiv - Biochemistry 2020Quote: ... using the Multiple Affinity Removal Column Human 14 (MARS 14, Agilent) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Exome fragments were captured using the SureSelect Human Exon V5 (Agilent) and sequenced on the Illumina HiSeq 2500 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were incubated with human-specific anti-Ki67 (DAKO, cat# M7240) or human specific anti-ClCaspase3 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2019Quote: ... MSH6 (Monoclonal Rabbit Anti-Human; Clone EP49, dilution 1 : 1000 Dako) PMS2 (Monoclonal Mouse Anti-Human ...