Labshake search
Citations for Agilent :
351 - 400 of 1356 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: 10 ul of RNA combined with 25 ng Human Universal Reference RNA (Agilent) was purified by PureBeads (Roche Sequencing) ...
-
bioRxiv - Genomics 2020Quote: ... Slides were additionally co-stained with rabbit anti-human vWF polyclonal antibody (Dako) at a dilution of 1:100 overnight at 4°C followed by donkey Alexa488-conjugated anti-rabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD68 (Dako, clone PG-M1, 1:750, pH 6 retrieval), mouse anti-human CD20 (Dako ...
-
bioRxiv - Cancer Biology 2020Quote: ... the following antibodies were used: anti-human Ki-67 (DAKO, clone Ki-67), anti-oestrogen receptor alpha (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Exome capture was performed with the SureSelect Human All Exon v6 kit (Agilent) and sequenced on the Illumina HiSeq platform ...
-
bioRxiv - Immunology 2021Quote: ... The specific primary antibody polyclonal rabbit anti-human CD3 (Dako, #A4052, California, USA) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein-coding genes were captured using SureSelectXT Human All Exon V5 probes (Agilent) and sequenced on Illumina HiSeq 4000 using 100bp paired end read protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... these slides were incubated with rabbit anti-human PGP 9.5 (DAKO 1:100) overnight at 4°C to mark the nerve fibers ...
-
bioRxiv - Immunology 2022Quote: ... cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary anti-human Ab (Dako) for 1□h at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... microglial lysosomes were stained using CD68 (mouse anti-human monoclonal primary antibody, Dako M0876,1:100 ...
-
bioRxiv - Immunology 2020Quote: ... followed by incubation with polyclonal antibodies against human kappa light chains (Dako, A0192) and by HRP-conjugated protein A (GE Healthcare ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-human CD20 clone L26 Dako Omnis (Agilent, Santa Clara, CA, USA). The secondary antibody used in this study included HRP Goat anti-Rabbit IgG (H&L ...
-
bioRxiv - Cancer Biology 2022Quote: ... Subsequently libraries were hybridized to specific SureSelect XT Human capture libraries (Agilent Technologies) and sequenced in paired-end mode (2×75 bp ...
-
bioRxiv - Immunology 2020Quote: ... and α-CD19 (clone HD37; Dako [α-human]; clone SJ25-C1 [α-mouse]) were added to 5 × 108 cells for 5 min at 37° ...
-
bioRxiv - Pathology 2020Quote: ... A polyclonal rabbit anti-human CD3 antibody (1:200; Agilent Technologies Inc, CA) was applied for 15 min and used with Leica Polymer Refine Detection kit to complete the staining.
-
bioRxiv - Pathology 2021Quote: ... Whole human genome oligonucleotide microarray (44K oligonucleotide DNA microarray, Agilent Technologies, Tokyo, Japan) was used for microarray experiments ...
-
bioRxiv - Genomics 2019Quote: ... and mouse monoclonal anti-human CD8 (DAKO, clone C8/144B, dilution 1:25) at 1 hour RT ...
-
bioRxiv - Physiology 2021Quote: ... Anti-human CD68 (mouse monoclonal IgG3, clone PG-M1, Dako, dilution 1/100) and anti-human IL-1β (rabbit polyclonal antibody ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing were generated using SureSelect Human All Exon 50Mb Kit (Agilent Technologies) coupled with Illumina HiSeq sequencing system (Illumina) ...
-
bioRxiv - Immunology 2020Quote: ... cells were incubated with fluorescein isothiocyanate (FITC)-conjugated secondary anti-human Ab (Dako) for 1□h at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Sequencing libraries were generated using Agilent SureSelect Human All Exon kit (Agilent Technologies) following the manufacturer’s recommendations and index codes were added to attribute sequences to each sample (experimental details provided in the Supplementary Data).
-
bioRxiv - Microbiology 2022Quote: ... Sections were stained with mouse anti human CMV (Dako, Agilent technologies, Glostrup, Denmark) primary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... gene expression analysis was carried out by Agilent Whole Human 44K Genome Oligo Array (G4112A, Agilent Technologies, Santa Clara, CA, USA) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2023Quote: Primary rat neurons or human i3Neurons were plated on Seahorse XFp plates (Agilent) at a density of 40,000 cells/well ...
-
bioRxiv - Genomics 2022Quote: ... and libraries were enriched with exome baits (Agilent SureSelect Human All Exon V6). Separate tumor sections were placed on 10X Visium arrays (slide serial number ...
-
bioRxiv - Immunology 2023Quote: ... and as secondary antibody we used anti-human IgG HRP antibody (Agilent P0214) diluted 1:8,000 in PBS + 1% SM ...
-
bioRxiv - Genomics 2024Quote: ... spiked into a background of human reference RNA (Agilent Technologies, Palo Alto, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... A SureSelect Human All Exon V6+UTR r2 core design (91 Mb, Agilent) was used for exon capture ...
-
bioRxiv - Bioengineering 2023Quote: ... human stem cell-derived ECs were cultured in the xCELLigence RTCA SP (Agilent) device and treated with cARLA or control medium exactly as described above ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Size exclusion chromatography-inductively coupled plasma-mass spectrometry was performed using an Agilent Technologies 1100 Series liquid chromatography system with a BioSEC 5 SEC column (5 μm particle size, 300 Å pore size, I.D. 4.6 mm, Agilent Technologies) and 7700x Series ICP-MS as previously described50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2021Quote: ... The substitution S59D and S59A were introduced into the pLVX-IRES-FLAG-tagged HERPUD1 vector using the QuikChange II XL direct-mutagenesis kit (Stratagene, cat#200522) and the mutagenesis service of GenScript (Hong Kong ...
-
bioRxiv - Cell Biology 2021Quote: ... pEGFPC1-FLAG-R258Q hSYNJ1-145 kDa and pEGFPC1-FLAG-R839C hSYNJ1-145 kDa [25] were re-engineered by site directed mutagenesis (Agilent QuikChange 200517) to delete the EGFP using the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... coli-optimized synthetic gene encoding the E2 ORF from HPV-16 (GenBank: AAD33255.1) was cloned into pCAL-N-FLAG (Agilent Technologies, CA, USA), which contains a vector-encoded N-terminal calmodulin bind site (CBS) ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2023Quote: ... A BioTek Cytation 5 (Agilent, Santa Clara, CA) was used to take representative images ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Immunology 2019Quote: ... single fractions were loaded onto a trap column (Zorbax 300SB-C18 5 µm, 5 × 0.3 mm, Agilent Biotechnologies, Palo Alto, CA) with a binary pump at a flow rate of 45 µL/min ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2022Quote: The supernatant and extract fractions were dissolved in 0.1% TFA solution in deionized water and applied to Agilent Prep 5 C18 column (10 x 250 mm, particle size 5 μm, Agilent Technologies). The processed McCYps and McCEco were first purified in 0.1% TFA/acetonitrile system in a linear 1-13% gradient of acetonitrile ...