Labshake search
Citations for Agilent :
201 - 250 of 5950 citations for Rat Mesoderm Specific Transcript Homolog Protein MEST ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... the included linker sequence between 3’ UTR and the start of sfGFP was removed using site-specific mutagenesis (QuikChange, Agilent). The gRNA expression plasmid and donor plasmid were injected by BestGene into embryos of Vas-Cas9 flies (#56552 ...
-
bioRxiv - Biochemistry 2020Quote: ... Site-directed mutagenesis was used to generate various specific mutations following the QuickChange protocol (Agilent Technologies, Santa Clara, CA, USA), using overlapping primers incorporating the mutation of interest ...
-
bioRxiv - Immunology 2021Quote: ... Product was amplified and barcoded with adaptor specific primers and the quality of the resulting libraries were determined by Agilent Bioanalyzer ...
-
bioRxiv - Cell Biology 2022Quote: ... Non-specific antibody binding was blocked by incubation for 30 min with blocking solution containing 5% normal goat serum (NGS, Dako) at room temperature followed by overnight incubation at 4 °C with different primary antibodies listed in Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... serial dilutions of the culture were spotted on PYE agar plates and exposed to specific energy settings in a UV Stratalinker 1800 (STRATAGENE). Growth was assessed from the number of spots on the plates after two days of incubation at 30°C ...
-
bioRxiv - Immunology 2020Quote: ... and bound mAbs were detected with rabbit anti-human IgG gamma chain-specific/HRP (Agilent: cat. P0214, 1:15,000 dilution).
-
bioRxiv - Microbiology 2021Quote: ... Specific antigen-antibody reactions were visualized by means of 3,3’-diaminobenzidine tetrahydrochloride staining using the Dako Envision system (Dako Cytomation).
-
bioRxiv - Systems Biology 2020Quote: ... The resulting Cy3-labeled cRNA was hybridized along with a uniform Cy5-labeled reference sample (as an internal standard) to custom gene-specific 8 x 60k oligonucleotide Agilent arrays (Agilent design ID ...
-
bioRxiv - Microbiology 2021Quote: ... cultures were transferred to a 90 mm petri plate and exposed to specific energy settings in a UV Stratalinker 1800 (STRATAGENE). During recovery (after UV and MMC damage ...
-
bioRxiv - Molecular Biology 2023Quote: ... we used horseradish peroxidase (HRP)-conjugated isotype-specific anti-rabbit IgG or anti-mouse IgG (1:10000; DAKO, Cambridgeshire, UK) secondary antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... along with gene-specific primers listed in Supplemental Table 3 and qPCR was performed in technical triplicate on a StepOnePlus (Stratagene). Ct values of target genes were normalized to β-actin and relative gene expression levels between conditions were calculated via the ΔΔCt method ...
-
bioRxiv - Microbiology 2023Quote: ... Petri dishes were removed from the anaerobic chamber and UV-irradiated with specific doses (mJ) in a UV Stratalinker 1800 (Stratagene) stored in a 37 °C room ...
-
bioRxiv - Microbiology 2023Quote: ... Specific antigen-antibody reactions were visualized by means of 3,3’-diaminobenzidine tetrahydrochloride staining using the Dako Envision system (Dako Cytomation). Histopathological severity score of pneumonia was determined based on the percentage of alveolar inflammation in a given area of a pulmonary section collected from each animal in each group using the following scoring system ...
-
bioRxiv - Cancer Biology 2023Quote: ... Gene-specific primers were used (Table S1) together with Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies), following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell Mito Stress Test was further combined with substrate pathway-specific inhibitors (etomoxir, UK5099, BPTES) (Agilent Technologies, Santa Clara, CA) to interrogate which of the three primary substrates (long chain fatty acids ...
-
bioRxiv - Immunology 2023Quote: ... Antigen specificity was then assessed by PyCSP-tetramer (SYVPSAEQI-specific H2-Kd tetramer, National Institutes of Health Tetramer Core) conjugated to streptavidin-allophycocyanin (ProZyme) per standard protocols ...
-
bioRxiv - Cancer Biology 2023Quote: ... tissue was permeabolized with 0,5% Triton X-100 in PBS (PBS-T) and non-specific binding was blocked by incubating the tissue section with blocking reagent (DAKO). Antibody staining was performed in PBS-T with 1% blocking reagent (DAKO ...
-
bioRxiv - Systems Biology 2020Quote: ... mouse and naked mole rat cells were plated onto a Seahorse XF96 Cell Culture Microplate (Agilent) at a cell density of 105,000 and 80,150 cells per well respectively to allow the cells to be 100% confluent ...
-
bioRxiv - Genomics 2019Quote: ... and hybridized onto SurePrint G3 Rat GE 8 x 60K Microarrays v2 (AMADID 074036; Agilent Technologies) for 16-20 h at 65°C in an Agilent oven with rotisserie ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-VWF (A0082, 1:1000) and rabbit anti-VWF-HRP (P0226, 1:8000) used for sandwich ELISA were purchased from Dako, sheep anti-VWF (ab11713 ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were washed between all experimental step with PBS plus 0.1% Tween 20 (405 TS ELISA Plate Washer, Agilent Technologies). Blocking (1% Omniblok ...
-
bioRxiv - Immunology 2023Quote: Antibodies against SARS-CoV-2 were measured using a high-throughput direct chemiluminescent ELISA performed on MicroLab STAR robotic liquid handlers (Hamilton) fitted with a 405TS/LS LHC2 plate washer (Biotek/Agilent) (full methods described previously)27 ...
-
bioRxiv - Systems Biology 2019Quote: ... Translating mRNA bound to the GFP-tagged ribosomal subunit protein L10a was then pulled-down and purified (Absolutely RNA Microprep Kit, Agilent Technologies, Wilmington, DE). RNA-Seq libraries were prepared from 1 μg of purified RNA using the NEBNext Ultra RNA Library Prep Kit for Illumina with NEBNext Poly(A ...
-
bioRxiv - Neuroscience 2021Quote: Purpose built rodent specific coils (circular coil 8mm in diameter and height-see [2]) controlled by an arbitrary waveform generator (Agilent 335141B) connected to a bipolar power supply (Kepco BOP 100-4M ...
-
bioRxiv - Molecular Biology 2020Quote: ... of the α-peptide sequence of the lacZ gene was amplified using Pfu DNA polymerase with specific primers (AlphaFor, CAGGAAACAGCTATGAC; AlphaRev, CCATTCGCCATTCAGGCTGCGCAA) and pBluescript KS- plasmid (Agilent Technologies) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... ESI–MS in positive ionization mode were carried out for specific fractions and analyzed by TOF detector (Agilent 1200 series, USA).
-
bioRxiv - Biophysics 2022Quote: Samples were collected at specific time-points during the aggregation process and the scattering measured in a spectrophotometer (Agilent Cary 60) at 320 nm.
-
bioRxiv - Neuroscience 2020Quote: ... to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK; 1:800) in Antibody Diluent (S0809, Agilent DAKO). Following removal of excess primary antibody with wash buffer ...
-
bioRxiv - Plant Biology 2021Quote: ... USA) using gene specific oligonucleotide (Supplemental table S3) and Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, USA). Relative gene expressions were calculated using 2−ΔΔCt method ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Immunology 2022Quote: Biotinylated MHC monomers with human β2-microglobulin specific for H-2Ld β-galactosidase (TPHPARIGL) were obtained from the NIH Tetramer Core Facility and tetramerized with streptavidin-PE (Prozyme). Decoy reagent was made according to published protocols (20) ...
-
bioRxiv - Cell Biology 2023Quote: ... Peak ion chromatograms for metabolites of interest were extracted at their specific m/z with Mass Hunter Quantitative Analysis software (Agilent Technologies). Ions used for quantification of metabolite levels were as follows ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... mouse (Fig. S8b) and naked mole-rat (Fig. 2a-c) marrowSeahorse XF96 Cell Culture Microplates (Agilent Technologies) between 50-250*103 cells per 200µl of the following culture media ...
-
bioRxiv - Immunology 2023Quote: ... using 1 µg/mL of rat anti-mouse IgM (AbD Biotec) or rabbit anti-mouse IgG1 (Dako) capture antibody ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein Block Serum Free reagent (Dako). Primary antibody incubation was performed at 4°C overnight using the ideal dilution for each antibody (Supplementary Table 5) ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated in Protein Block (Dako) for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... and protein (Dako cat. no. X0909) blocking reagents for 5 minutes each ...
-
bioRxiv - Microbiology 2023Quote: ... AdvanceBio SEC 300Å protein standard (Agilent) was included to correlate the elution volume with molecular weight.
-
bioRxiv - Microbiology 2023Quote: ... diluted with protein block buffer (Dako) for 2 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Dako Protein Block (Agilent Cat#X0909), ‘Normal’ block (Agilent Cat#S202386-2) ...
-
bioRxiv - Microbiology 2020Quote: Two different glycosidases were used for specific removal of N-glycans: peptide N-glycosidase F (PNGase F) and endo N-glycosidase H (Endo H) (Prozyme, Hayward, CA). PNGase F removes all N-glycans from gp120/41 glycoprotein whereas Endo H removes high-mannose and hybrid glycans ...
-
bioRxiv - Immunology 2023Quote: ... After incubation with the rIgE’s the wells were washed four times with ELISA wash buffer and incubated with 100 μL of 1,3 μg/mL rabbit anti-human IgE-conjugated HRP (DAKO, cat no: P0295) for 1 hour at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the coverslips were incubated in donkey anti goat-647 for TRKB and donkey anti rabbit-568 for the RAB-specific antibodies for 45 min at RT and fixed in Dako Fluorescence Mounting Medium (S3023, Dako North America, Inc.). Control coverslips without primary antibody staining were also included.
-
bioRxiv - Immunology 2020Quote: ... proteins were tetramerized with streptavidin-APC (Prozyme) or streptavidin-AlexaFluor488 (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were tetramerized with streptavidin-APC (Prozyme), streptavidin–Alexa Fluor 488 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...