Labshake search
Citations for Agilent :
101 - 150 of 7140 citations for RNA Binding Motif Protein 45 RBM45 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Mutations of the two Walker-A motifs in human ABCF1 (K324M, K664M) were created by using Quikchange II Site Directed Mutagenesis Kit (Agilent). Human ABCF1 and yeast GCN20 domain fusion cDNAs were created by PCR-mediated ligation and cloned into modified pMtac-His6 vector ...
-
bioRxiv - Biochemistry 2019Quote: ... the relevant tetrapeptide motifs were inserted into iBox-PAK4cat within the pXJ40 vector [1] using the Quikchange II Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... A targeted mutation in the Nudix motif was introduced through use of the QuikChange site-directed mutagenesis kit (Agilent Technologies) to produce a plasmid encoding L375 (E258Q).
-
bioRxiv - Microbiology 2021Quote: ... Site-directed mutations in the putative Nla28 binding site were generated using the Quickchange system (Agilent) as previously described (5 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Primary anti-CD31 antibody in Tris-HCl buffer containing stabilizing protein and 0.015 mol/L sodium azide (Dako Antibody Diluent ...
-
bioRxiv - Neuroscience 2020Quote: Primary antibodies used for immunofluorescence on brain sections were polyclonal rabbit anti-glial fibrillary acidic protein (GFAP; DAKO, Santa Clara ...
-
bioRxiv - Pathology 2021Quote: ... the sections were immunostained with antibodies against the following: glial fibrillary acidic protein (GFAP, polyclonal, 1:1,500, Dako); α-smooth muscle actin (SMA ...
-
bioRxiv - Cancer Biology 2020Quote: ... All antibody conjugates were run on a Bioanalyzer Protein 230 electrophoresis chip (Agilent Technologies, cat. no. 5067-1517) to verify successful conjugation.
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies (Abs) against glial fibrillary acidic protein (GFAP, rabbit anti-GFAP (1:2000, Dako, Z0334, RRID: AB_10013382)) and neuronal nuclear antigen (NeuN ...
-
bioRxiv - Immunology 2022Quote: ... C antibody (clone W6/32) that was immobilized and covalently linked to Protein A cartridges (Agilent G5496-60000). Peptides were acid eluted from antibody bound ProteinA cartridges using 0.1M acetic acid/0.1%TFA followed by desalting with C18 solid-phase extraction (SPE) ...
-
bioRxiv - Neuroscience 2023Quote: Free-floating brain tissue was stained for polyclonal rabbit anti-glial fibrillary acidic protein primary antibody (GFAP; DAKO, Santa Clara ...
-
bioRxiv - Developmental Biology 2020Quote: ... p10UAST-Robo1-MYC and the p5UAST-HA-Robo1 constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Robo coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Cell Biology 2021Quote: ... or of the phospho FFAT motif (Y768A, T770A, T770D/P771A) were generated using site-directed mutagenesis (QuikChange II XL; Agilent technologies) of EGFP-Miro1 ...
-
bioRxiv - Neuroscience 2022Quote: ... the following primers were used to mutate the WIRS motif in the pcDNA3-DCCWT-HA construct using the Quikchange II site-directed mutagenesis kit (Agilent, #200523): CAACTCACCCACTCCGCGCCGCTGCTAATCCTTTGCTACC and GGTAGCAAAGGATTAGCAGCGGCGCGGAGTGGGTGAGTTG ...
-
bioRxiv - Neuroscience 2022Quote: ... and the p5xUAST-Fra-Myc constructs were subcloned into the smaller pBlueScript backbone and point mutations were introduced into the WIRS motif of the Fra coding sequences with the Quikchange II site-directed mutagenesis kit (Agilent, #200523) using the following primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mutagenesis of the HDE-like motifs and PAM sequence within donor plasmid for HDR was performed using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). pcDNA3.1(+)-ARRDC4-1 and pcDNA3.1(+)-ADCYAP1-2 expression vectors were constructed by cloning lnc-ARRDC4-1 and lnc-ADCYAP1-2 sequences to pcDNA3.1(+ ...
-
bioRxiv - Cell Biology 2023Quote: ... TP53-missense mutations and protospacer adjacent motif (PAM) sequence mutation were introduced using the QuikChange Lightning site-directed mutagenesis kit (Agilent Technologies). A puromycin or neomycin resistance cassette was cloned into the BamHI site which was placed between left- and right-arm of the amplified and cloned DNA fragments ...
-
bioRxiv - Molecular Biology 2023Quote: ... The desired PNUTS mutant in the RVXF motif (converting the RISW motif to RASA) was generated by oligonucleotide-mediated site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Cholesterol and its influence on Gb3 binding were analyzed by targeted LC-QqQ-MS (6460, Agilent Technologies) operated in SRM/MRM mode ...
-
bioRxiv - Developmental Biology 2020Quote: ... Mutagenesis of the putative Sp1 binding sites was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). All the reporter constructs were inserted and analyzed at the same landing attP site ...
-
bioRxiv - Neuroscience 2021Quote: ... 25 and 50 ppb with Sc-45 (ICP-MS internal standard mix 1 ug/mL in 2% HNO3, Agilent Technologies) as the internal standard for Cu-63.
-
bioRxiv - Cancer Biology 2021Quote: ... followed by incubation for 45 minutes at room temperature in 1:100 dilution of rabbit anti-goat immunoglobulins/HRP (Dako, P0160 or ready-to-use goat anti-rabbit HRP labelled polymer (Dako ...
-
bioRxiv - Genomics 2021Quote: ... in a final reaction volume of 40 μl following Carøe et al.45 and amplified using PfuTurbo Cx HotStart DNA Polymerase (Agilent Technologies) and Phusion® High-Fidelity PCR Master Mix with HF buffer (New England Biolabs Inc ...
-
bioRxiv - Cell Biology 2023Quote: ... Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan) (45) and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) in order to obtain peak information including m/z ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used were rabbit anti-cow glial fibrillary acidic protein (GFAP; 1:5000; Z0334; Dako, Carpinteria, CA, USA) to detect astrocytes ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein lysates were incubated at 4°C with a mouse monoclonal antibody directed against the FLAG-tag (M2, Stratagene). Immunocomplexes were pulled down by incubation with protein G sepharose ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were revealed by chemi-luminescence (Super Signal West Dura Substrate, Pierce) using a secondary peroxydase-conjugated antibody (Dako) at a dilution of 1:10000 ...
-
bioRxiv - Microbiology 2022Quote: ... The MHC-II binding site mutations were introduced into pKK33 by site-directed mutagenesis (QuickChange II, Agilent Technologies) using the primer set SECF44A/L45Afor/ SECF44A/L45Arev ...
-
bioRxiv - Immunology 2021Quote: ... membranes were incubated for 45 minutes in 1% dried skim milk in PBS-T with rabbit anti-human C1q (1:300, Dako, A0136) and HRP-conjugated goat anti-rabbit IgG (1:10.000 ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Bioengineering 2022Quote: Cells were equilibrated 45 min before metabolic characterization in initial volume 150 μL Seahorse XF base medium (103334-100, Agilent Technologies) containing additional (in mmol L−1 ...
-
bioRxiv - Physiology 2022Quote: ... the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen retrieval was performed by heating slides in a pressure cooker for 45 minutes with Target Antigen Retrieval Solution (Dako, S1699). Sections were blocked with 10% goat serum for 30 minutes and primary antibodies were incubated at 4°C overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein blocking was performed using protein block solution (DAKO) for 30 minutes at room temperature ...
-
bioRxiv - Pathology 2019Quote: ... FLAG-tag was inserted between the CAAX motif (CVIQ) and stop codon in the full-length construct (Cat No: 200523, QuickChange II Site-Directed Mutagenesis kit, Agilent Technologies, Lexington, MA). For removal of the INF2 cleavage site ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The multiple charged peaks of the antibody were deconvoluted using the Agilent MassHunter Bioconfirm software (deconvolution for protein, Agilent technology) with the deconvolution range from 20 kDa to 160 kDa ...
-
bioRxiv - Bioengineering 2019Quote: ... The primary antibodies sources and dilutions were as follows: rabbit poly-clonal anti-glia fibrillary acidic protein (GFAP; 1:500; DAKO), mouse monoclonal anti-Neuronal Class III B-Tubulin (TuJ1 ...
-
bioRxiv - Bioengineering 2022Quote: ... and incubated overnight at 4 °C with primary antibodies for the glial fibrillary acidic protein (GFAP; 1:1000, Z0334, Dako), ionised calcium-binding adapter molecule 1 (IBA1 ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections were incubated overnight with the following primary antibodies: rabbit polyclonal anti-glial fibrillary acidic protein (GFAP) (1:6,000, DAKO, UK), rabbit polyclonal anti-allograft inflammatory factor 1 (IBA1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The slides were probed with a set of 216 antibodies against total and phospho-proteins using an automated slide stainer Autolink 48 (Dako). Each slide was incubated with one specific primary antibody ...
-
bioRxiv - Systems Biology 2022Quote: ... the RNA integrity number was 10 as assessed by the Stanford Protein and Nucleic Acid (PAN) Biotechnology Facility using the RNA Nano Kit (Agilent #5067-1511) on an Agilent Bioanalyzer ...
-
bioRxiv - Microbiology 2023Quote: ... The TEAD-binding defective HPV8 E6 K136N mutant was made using the QuikChange II site-directed mutagenesis kit (Agilent). Nuclear/cytoplasmic fractionation was performed using the previously published Rapid ...
-
bioRxiv - Developmental Biology 2023Quote: ... Mutations in the miRNA binding sites were introduced using the QuikChange II XL system (Agilent Technologies; CatNo. 200521-5). Primers used are shown in Additional file 1 ...
-
bioRxiv - Systems Biology 2024Quote: ... Mutation of the miRNA seed-binding sites was performed using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) (Supplementary Figure 2) ...
-
bioRxiv - Physiology 2022Quote: ... Immunologic), the HRP-Anti-Rat IgG (MP-7444, Vector) for 45 min or the Goat Anti-Mouse Immunoglobulins/HRP (Dako-Agilent, P0447) at 1:100 for 30 min ...
-
bioRxiv - Physiology 2023Quote: ... slides (4 μm thickness) were baked at 60° C for 45 min and treated with a low pH target retrieval solution (#DM829; Dako, Glostrup, Denmark) in a DAKO PT Link HIER machine (PTlink 200 ...
-
bioRxiv - Genetics 2023Quote: ... 15 PCR-2 reactions were completed using Oligo 45 paired with Oligos 47-61 to amplify from YCp50-WT_PKR plasmid using Herculase II polymerase (Agilent Technologies Cat#600677) using cycling conditions for vector targets >10 kilo-base pairs ...
-
bioRxiv - Bioengineering 2023Quote: ... protein block with Dako protein block solution (Dako, Glostrup, Denmark), incubation with primary antibodies [eGFP (Abcam ...
-
bioRxiv - Biochemistry 2020Quote: ... and Ile-residues of the HXXXDX motif of ZmGL2 and ZmGL2-LIKE were generated using QuikChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). The ZmGL2 protein was also expressed in E ...
-
bioRxiv - Cancer Biology 2019Quote: ... protein block (Dako) for 10 minutes at room temperature ...