Labshake search
Citations for Agilent :
401 - 450 of 7498 citations for Mouse Cytochrome C Oxidase Subunit II COX2 MT CO2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Point mutations were made using Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA). The sequences of the DNA constructs were confirmed by fluorescence-based DNA sequencing (Genewiz LLC ...
-
bioRxiv - Microbiology 2021Quote: ADAP1 and KRAS point mutants were generated using QuikChange II XL Site-Directed Mutagenesis kit (Agilent, 200522) per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Truncations were generated by stop codon insertion mutagenesis with QuikChange II XL mutagenesis kit (Agilent, cat# 200522), and GFP fusion expressing the STAT2 CC domain alone was constructed by PCR with specific primers to enable cloning into plasmid pEGFP-N1 or pEGFP-C1 ...
-
bioRxiv - Biochemistry 2022Quote: ... which was labelled with alpha-32P-ATP using the Prime-It II Random Primer Labelling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Each mutagenesis reaction was performed using QuikChange II Site-directed Mutagenesis kit (Agilent, Santa Clara, CA, USA) and the mixtures were made according to manufactures guidelines ...
-
bioRxiv - Biophysics 2022Quote: ... Site-directed mutagenesis were introduced into plasmids using QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2022Quote: ... We generated the 873-1159-Citrine ΔNLS mutant using site-directed mutagenesis (QuikChange II Kit, Agilent Technologies) using the distal plasmid as a template ...
-
bioRxiv - Immunology 2022Quote: ... Myc-NEU3 mutants were generated using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA) with the DNA oligomers GGGCCCCTTAAACCACTTATTGAATCCACACTACC for mutant 1 and CAGTTCACTTAGACTGGAAGATGAATCTGGAACAC for mutant 2 ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). For expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Microbiology 2022Quote: ... This was achieved by site-directed mutagenesis (QuikChange II Site Directed Mutagenesis Kit (Agilent, Santa Clara, CA)) using the primers EmaA-Pro-X-Gly-F and EmaA-Pro-X-Gly-R (Table 2 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA for E111V variant was obtained by PCR using QuikChange II Site-Directed Mutagenesis kit (Agilent) as described in ref ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mutant constructs (mut_GLA_FLAG/pCR3.1) were prepared by site-directed mutagenesis (Site-Directed Mutagenesis Kits, QuickChange II, Agilent) and selected by sequencing.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The mutant M1237I spike related constructs were generated using the QuikChange II site-directed mutagenesis kit (Agilent) with the primer set of S-M1237I-F ...
-
bioRxiv - Molecular Biology 2022Quote: ... The TRPM2 and TRPML1 mutant forms were produced using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Physiology 2023Quote: ... The desired mutations for MYH7 were introduced using the Quick ChangeXL II Site Directed Mutagenesis Kit (Agilent) according to the manufacturers’ instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Site-directed mutagenesis was performed using the Agilent Quikchange II XL kit (Agilent Technologies, Santa Clara, CA) was used to individually introduce the I467V and I467T mutations into the S1 motor domain and confirmed via cDNA sequencing ...
-
bioRxiv - Genomics 2023Quote: ... PCR amplicons were generated using the Agilent Herculase II Fusion Polymerase with dNTPs Combo Kit (Agilent, #600677). In brief ...
-
bioRxiv - Cancer Biology 2023Quote: ... pEF-MYC RAF1 S471A was made using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies), Forward Primer ...
-
bioRxiv - Developmental Biology 2023Quote: ... The dCas9-KRAB donor was generated through two rounds of QuikChange II Site-Directed Mutagenesis Kit (Agilent), using Puro-Cas9 donor (Addgene plasmid 58409 ...
-
bioRxiv - Neuroscience 2023Quote: ... Probes were labeled with 32P using the Prime-It II Random Primer Labeling Kit (Agilent Cat. #300385).
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis was performed using Agilent QuikChange II site-directed mutagenesis kit (Agilent, Santa Clara, CA) according to the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2023Quote: ... The additional K198A and D306N were then introduced using the QuikChange II site-directed mutagenesis kit (Agilent). The same kit was used to generate the HA-tagged D159A and H185R SLC39A9 mutants ...
-
bioRxiv - Neuroscience 2023Quote: ... The mutation A243V was introduced into the GluN2A plasmid using the QuickChange II XL kit from Agilent. All portions of the resulting construct that were subject to PCR were confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... QuickChange primers as well as the QuickChange II site-directed mutagenesis kit (Agilent Technologies, Santa Clara, USA) were used to incorporate point mutations into human GAT1 ...
-
bioRxiv - Biochemistry 2023Quote: The inactive mutant of LytMcat (LytMcat_H291A) was generated using QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies) and the mutation was verified by sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... Active sites of ATG4A and ATG4B were mutated using QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523) and primer pairs AM 622/AM 623 and MA 624/625 ...
-
bioRxiv - Molecular Biology 2024Quote: Mpro mutants were generated using the QuikChange® II Site-Directed Mutagenesis Kit from Agilent (Catalog #200524), using pET-SUMO-Mpro (from strain BetaCoV/Wuhan/WIV04/2019 ...
-
bioRxiv - Synthetic Biology 2024Quote: The SrIRED gene was amplified with error-prone PCR using the GeneMorph II random mutagenesis kit (Agilent) following the instructions of the manufacturer using 2.4 µg template plasmid and 25 PCR cycles ...
-
bioRxiv - Microbiology 2023Quote: ... Site-directed mutagenesis on the pmPol I-LASV Sag plasmid was performed using QuikChange II kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Site-directed mutagenesis was performed using the QuikChange II XL site-directed Mutagenesis Kit (Agilent Technologies, 200521) as per the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Point mutations were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent, Santa Clara, CA) and confirmed by direct sequencing (GENEWIZ) ...
-
bioRxiv - Microbiology 2024Quote: ... site-directed mutagenesis was performed on pCMVΔR8.91 using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions and using the following primers ...
-
bioRxiv - Biochemistry 2024Quote: K125R and K125E mutations of human connexin 26 were prepared using the QuikChange II mutagenesis kit (Agilent) and the following primers ...
-
bioRxiv - Genetics 2019Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first pooled and shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Developmental Biology 2021Quote: ... Final Hi-C libraries were quantified using Qubit dsDNA HS assay kit and a DNA HS kit on a 2100 Bioanalyzer (Agilent). Libraries were first shallow sequenced on an Illumina MiSeq (2×84bp paired-end ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein lysates were incubated at 4°C with a mouse monoclonal antibody directed against the FLAG-tag (M2, Stratagene). Immunocomplexes were pulled down by incubation with protein G sepharose ...
-
bioRxiv - Cancer Biology 2024Quote: ... One microgram or more of mouse genomic DNA from each sample was analyzed by whole exome sequencing using the SureSelectXT Mouse All Exon kit (Agilent), followed by next generation sequencing using the NovaSeq 6000 S4 flow cell (Illumina ...
-
bioRxiv - Physiology 2021Quote: ... Dako Animal Research Kit for mouse primary antibodies (Dako Diagnóstico S.A., Spain) was used for the qualitative identification of antigens by light microscopy ...
-
bioRxiv - Immunology 2019Quote: ... The sections were incubated in the kit polymer-HRP anti-mouse (Dako En Vision+ System-HRP ...
-
bioRxiv - Cancer Biology 2020Quote: ... QuickChange II sitedirected mutagenesis (Agilent) was used to introduce a single mutation C402G to obtain a FOXL2C134W mutant ...
-
bioRxiv - Cell Biology 2019Quote: ... or Herculase II Fusion (Agilent) DNA polymerases with primers listed in Supplementary Table 5.
-
bioRxiv - Plant Biology 2020Quote: ... site-directed mutagenesis (SDM) was performed using a QuikChange II Site-Directed Mutagenesis Kit (Agilent, Santa Clara, US). Primer sequences for SDM are included in Table S9.
-
bioRxiv - Biophysics 2021Quote: ... Point mutants were engineered into the DHFR gene using QuikChange II site-directed mutagenesis kits (Agilent cat#200523) using primers specified in Appendix 1 ...
-
bioRxiv - Biophysics 2021Quote: ... R214Q/K219N/R353Q triple mutation) were generate using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent) and verified by sequencing the entire cDNA construct ...
-
bioRxiv - Biophysics 2021Quote: The error-prone PCR reaction for libraries “SH3_EP” was done using the GeneMorph II Mutagenesis Kit (Agilent Technologies) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: Mutagenesis of the sequence encoding Sir3464-728 using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent, 200552-5) was performed by PCR on 9,5 µg of pACT2-SIR3464-728 with 20 cycles of amplification to allow low mutation rate ...
-
bioRxiv - Neuroscience 2020Quote: ... The V990M and P1090Q mutants were generated using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). For the GPCR regulation of these mutants ...
-
bioRxiv - Microbiology 2021Quote: ... we generated a pT7-D6/2-NSP1-null via the QuikChange II site-directed mutagenesis kit (Agilent Technology) based on pT7-D6/2-NSP1 (22) ...
-
bioRxiv - Neuroscience 2021Quote: ... Missense mutations were introduced by site-directed mutagenesis using the Quik-Change II site-directed mutagenesis kit (Agilent) and mutagenic oligonucleotides obtained from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... S27 isolate-based plasmid via site-directed mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies). The following mutations were introduced ...