Labshake search
Citations for Agilent :
351 - 400 of 7498 citations for Mouse Cytochrome C Oxidase Subunit II COX2 MT CO2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... The hHVEM mutant library was generated using the QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies). Full length of WT mHVEM and mutants were cloned into pmCherry-N1 vector (Clontech) ...
-
bioRxiv - Neuroscience 2021Quote: ... The αSyn K96R variant was generated using the Quick-Change II site-directed mutagenesis kit (Stratagene) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Mutagenesis reactions were performed with QuikChange II Site-Directed Mutagenesis kit (Agilent Technologies, Santa Clara, USA) following the manufacturer protocols ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We generated mutant libraries of each gene via random mutagenesis with the Mutazyme II kit (Agilent), using 200ng of DNA template and eight cycles of mutagenic PCR ...
-
bioRxiv - Microbiology 2020Quote: ... Point mutations N74D and A77V were introduced using the QuikChange II site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... All point mutations were introduced with a QuickChange II XL site-directed mutagenesis kit (Agilent Technologies). All constructs were confirmed by sequencing ...
-
bioRxiv - Immunology 2021Quote: Antibody gene mutations were introduced by QuikChange II site directed mutagenesis kit (Agilent, Cat. No. 200524)
-
bioRxiv - Molecular Biology 2023Quote: ... The protocol for large insertions provided by the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) was followed to insert TOM20 or H2B in place of the TFAM gene TFAM-mScarlet_pWPXL plasmid ...
-
bioRxiv - Biochemistry 2023Quote: ... MIEG3 expression vectors containing IER5 mutations were generated by QuickChange II Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2023Quote: ... The BDF1 point mutant plasmids were obtained using the QuikChange II Site-directed mutagenesis kit (Agilent) with the BDF1 plasmid pJG267 ...
-
bioRxiv - Biochemistry 2023Quote: ... Additional rounds of site directed mutagenesis using the QuikChange XL II site directed mutagenesis kit (Agilent) were applied to create Ptch1 KR (ATT/LIN)-His ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of FAM104A isoform 5 was mutated using the QuikChange XL II kit (Agilent) with primers FAM104A_NL-RR_fwd (5’-cct cta ctt cca cat ccg cca gac ccg cag gga ggc cca ctt cc) ...
-
bioRxiv - Physiology 2020Quote: ... and rotenone/antimycin A (Port C) (XF Cell Mito Stress Test Kit, Agilent) to achieve final concentrations of 1 μM ...
-
bioRxiv - Molecular Biology 2019Quote: ... using Herculase II (Agilent) to amplify the DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... or Herculase II (Agilent). PCR was performed for 16 cycles using primers with the desired nucleotides changes incorporated at or near the 5’ ends ...
-
bioRxiv - Cell Biology 2024Quote: ... carrier pBlueScript II (Agilent) empty plasmid was used to bring the total amount of DNA up to 1 µg ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with primary antibodies at 4°C overnight: mouse monoclonal anti-CD31 (1:100, JC70A, Dako), rabbit polyclonal anti-VWF (1:100 ...
-
bioRxiv - Bioengineering 2022Quote: ... then incubated separately for 30 min at 37 °C with secondary Ab (anti-mouse ab HRP conjugated, DAKO Envision K4001 or anti-rabbit ab HRP conjugated ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were incubated overnight at 4°C with the following primary antibodies: mouse anti-BrdU (1:100, Dako), rat anti-BrdU (1:100 Oxford Biotech) ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Neuroscience 2022Quote: ... and the Dako Envision Flex Plus Mouse Link Kit (Agilent, USA) to detect the antibody along with the Dako DAB (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... and the Dako Envision Flex Plus Mouse Link Kit (Agilent, USA) to detect the antibody along with the Dako DAB (Agilent ...
-
bioRxiv - Genomics 2020Quote: ... 1X Herculase II Polymerase buffer and 1X Herculase II polymerase (Agilent Technologies, USA). We immediately thermo-cycled samples with the following temperature-time profile ...
-
bioRxiv - Biochemistry 2021Quote: ... The plasmids encoding substratebdmt and (UBLbd & TPRd)mt SGTA-V5-BioID2-HA were generated by site-directed mutagenesis with PfuTurbo DNA polymerase (Agilent Technologies). Full-length human MAVS cDNA was transferred from pGEM- MAVS (Sino Biological HG15224-G ...
-
bioRxiv - Systems Biology 2019Quote: ... 20% of the total mixture was incubated at 37°C with PNGaseF and fractionated into 16 high pH reversed phase fractions using a 1260 Infinity II HPLC (Agilent Technologies, Santa Clara, CA) with a 4.6 × 150 mm XBridge C18 column and a 30 minute gradient (mobile phase A ...
-
bioRxiv - Physiology 2022Quote: ... Point mutations were made using Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA). The human KCNQ2 and human KCNQ3 constructs were fused with sequence of the enhanced YFP at the carboxyl-terminal end ...
-
bioRxiv - Neuroscience 2019Quote: ... pPBase-BRAFwt was generated with quick change II XL single nucleotide site directed mutagenesis kit from Agilent according to the manufacturer protocol ...
-
bioRxiv - Immunology 2020Quote: ... and was probed using dCTP-32P labeled probes made using the PrimeIT II kit (Agilent, cat. 300385) and Roche Quick Spin Columns (TE ...
-
bioRxiv - Pathology 2019Quote: ... Sections were stained using the CSA II kit (Biotin-free catalysed signal amplification system; DAKO, Glostrup, Denmark) and 3,3’-diaminobenzidine (DAB) ...
-
bioRxiv - Cell Biology 2019Quote: ... H3 S10A and H3 S10E using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent technologies, cat#200521) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... site directed mutagenesis was carried out by using Quik Change II Site-Directed Mutagenesis Kit (Agilent, USA). The primers used were ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the homology arms containing plasmid was mutated using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, #200522) to delete the single-guide RNA (sgRNA ...
-
bioRxiv - Biochemistry 2021Quote: ... Site Directed Mutagenesis was carried out using the QuikChange Lightning II cloning kit (Agilent, Santa Clara, CA). PCR cloning was carried out using the NEB PCR cloning kit ...
-
bioRxiv - Biochemistry 2020Quote: ... All mutants of IFITM3 were generated by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, #200523). Lipofectamine 3000 from Thermo Scientific was used for transfection of HEK293T cells.
-
bioRxiv - Cell Biology 2021Quote: ... The QuikChange II XL direct-mutagenesis kit was obtained from Stratagene (cat#200522, La Jolla, CA, USA) and the Vybrant Apoptosis Pacific Blue-annexin V kit and 7AAD from Invitrogen (cat#A35122).
-
bioRxiv - Microbiology 2021Quote: ... Point mutants were generated using the QuikChange II site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... were generated using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer’s instructions (Agilent). To make the constructs for expression of stabilized soluble S2P spike trimer proteins ...
-
bioRxiv - Microbiology 2022Quote: ... Altered rsmY and rsmZ reporters were constructed using the QuikChange II XL site-directed mutagenesis kit (Agilent) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... site-directed mutagenesis was performed on pCMVΔR8.91 using the QuickChange II-XL site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions and using the primers listed in Supplementary Table 1 ...
-
bioRxiv - Genetics 2019Quote: ... the C583Y mutation was introduced into the slc12a7a/kcc4a pXT7 construct using a QuikChange II Kit (Agilent) as per the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2019Quote: ... Radioactive probes were synthesized using a Prime-It II Random Primer Labeling Kit (300385, Agilent Technologies, Inc).
-
bioRxiv - Microbiology 2020Quote: ... Two rounds of error-prone PCR were performed using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). The PCR product was cloned into the PADL22c vector and transformed via electroporation into the TG1 E ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Pathology 2020Quote: ... Site-directed mutagenesis was performed with the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and primers were designed using the QuikChange Primer Design tool (Agilent Technologies).
-
bioRxiv - Immunology 2020Quote: Viral mutants were generated by site-directed mutagenesis using the Quikchange II Site-directed mutagenesis kit (Agilent) with forward and reverse primers specific for each mutation (Key Resources Table) ...
-
bioRxiv - Genetics 2019Quote: ... The catalytically inactive point mutation C265S43 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to create T7-DNMT3B2 catalytic dead (CD) ...
-
bioRxiv - Microbiology 2019Quote: ... point mutants were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... These SNPs were made using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology, 200521). The gRNA and c(3)GccΔ1 homologous repair template plasmid were sent to Genetivision (Houston ...
-
Gatekeeper helix activates Golgi SM protein Sly1 and directly mediates close-range vesicle tetheringbioRxiv - Cell Biology 2020Quote: ... a library of SLY1* mutant alleles was constructed using the GeneMorph II Random Mutagenesis Kit (Agilent #200550). The SLY1 open reading frame was amplified using the “medium mutation rate” PCR protocol ...
-
bioRxiv - Cell Biology 2019Quote: Generation of pGDB-SDEL plasmid was done using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) on the pGDB plasmid with primers P1 and P2 per the manufacturer’s protocol36.