Labshake search
Citations for Agilent :
101 - 150 of 592 citations for 8 Bromo 3 iodo quinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... These data were obtained with Agilent SurePrint G3 Human GE v2 8×60K microarray (Agilent Technologies) from peripheral blood samples (all samples had RNA integrity number (RIN ...
-
bioRxiv - Developmental Biology 2021Quote: ... The cRNAs were hybridized on a SurePrint G3 Mouse Gene Expression 8 × 60K Microarray (Agilent Technologies), and fluorescence signals were detected using the SureScan Microarray Scanner (Agilent Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Genomics 2019Quote: ... and hybridized onto SurePrint G3 Rat GE 8 x 60K Microarrays v2 (AMADID 074036; Agilent Technologies) for 16-20 h at 65°C in an Agilent oven with rotisserie ...
-
bioRxiv - Immunology 2021Quote: ... antigen retrieval was performed in Tris buffer pH 8 with 10 mM EDTA (PT link, Agilent). Immunofluorescent staining was performed using the Bond RX Fully Automated Research Stainer (Leica biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 80/100 alumina column (1/8” x 2 mm x 1.5 m, Agilent) and set with the following parameters ...
-
bioRxiv - Neuroscience 2020Quote: ... The microarray was performed using the SuperPrint G3 Mouse GE 8×60K Microarray Kit (Agilent, #G4852A) and a DNA microarray scanner ...
-
bioRxiv - Physiology 2021Quote: ... fed and active season bears were thawed and plated in 8-well Seahorse XFp Miniplates (Agilent) and processed as described above ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... achieving RNA integrity (RIN) in the range of 8-10 (Agilent Bioanalyzer Total RNA Pico Assay). First strand cDNA synthesis of DBD-specific regions was carried out using RevertAid H Minus Reverse Transcriptase (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... Total RNA was examined using the SurePrint G3 Mouse GE 8×60K Microarray (Agilent Technologies, USA.). Data were quantified using the Agilent Feature Extraction software (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... the analysis was performed using one color SurePrint G3 Human GE 8×60k Microarrays (Agilent Technologies), and the data is available in the ArrayExpress database (http://www.ebi.ac.uk/arrayexpress ...
-
bioRxiv - Cell Biology 2022Quote: ... Frozen blocks were tested for RNA quality with RIN > 8 for frozen tissues (RNA pico, Agilent) and three tissue optimisation experiments (10x Genomics ...
-
bioRxiv - Genomics 2022Quote: ... RNA concentrations were quantified (Nanodrop) and subsequently analyzed via fragment analysis (BioAnalyzer, Agilent, all RIN > 8). RNA libraries were prepared using Illumina polyA total RNA kit ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... An RNA integrity number > 8 was confirmed by Bioanalyzer RNA analysis (Agilent Technologies, Inc, CA, USA).
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Molecular Biology 2020Quote: Cybrid cells were plated according to manufacturer’s instructions on 8-well Seahorse XFp plates (Agilent, 103010-100). The day of the assay ...
-
bioRxiv - Developmental Biology 2022Quote: ... Hybridization to 8×60K 60mer oligonucleotide spotted microarray slides (Human Mouse Genome, Agilent Technologies, design ID 074809) and subsequent washing and drying of the slides were performed following the Agilent hybridization protocol in Agilent hybridization chambers ...
-
bioRxiv - Physiology 2021Quote: ... Génopole Toulouse Midi-Pyrénées) using Sureprint G3 Mouse GE v2 microarrays (8×60K, design 074809, Agilent Technologies), according to the manufacturer's instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 200 μl of distilled water was added to the sensor-containing Seahorse 8-well fluxpaks (Agilent Technology), which were coated with Poly-D-Lysine ...
-
bioRxiv - Biochemistry 2019Quote: ... all samples were processed and hybridized to SurePrint G3 Mouse Gene Expression 8 × 60 K (Agilent Technologies). Fluorescence was detected using Agilent DNA Microarray Scanner ...
-
bioRxiv - Neuroscience 2023Quote: Neurospheres were removed from 96-well plates and pipetted into 8-well Seahorse XF HS miniplates (Agilent) coated with 15 µg/mL poly-L-ornithine and 10µg/mL laminin ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Immunology 2024Quote: Initial experiments were conducted with an 8-well Seahorse XFp extracellular flux analyser (Seahorse Bioscience, Inc, USA) to determine cell seeding density and FCCP concentration (Supplementary Data) ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.75 μg labeled cRNA was fragmented and hybridized to custom whole-genome human 8 × 60K microarrays (Agilent-048908) according to the supplier’s protocol (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2022Quote: ... a genome-wide gene expression profiling was set up using the 8×60K ArrayXS Zebrafish platform by Agilent and performed by OakLabs GmbH (Henningsdorf ...
-
bioRxiv - Neuroscience 2020Quote: ... Cy3-labeled RNAs were hybridized to SurePrint G3 Mouse Gene Expression v2 8×60K Microarray Kit (Agilent Technologies) at 65 °C for 17h ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed with water and then blocked in a serum-free protein block buffer for 8 min (Dako, X0909). Primary CD133 antibody (Miltenyi Biotec ...
-
bioRxiv - Molecular Biology 2022Quote: Single color Agilent SurePrint G3 Custom Gene Expression Microarray 8 x 60K (Agilent, Agilent-048908; GEO Platform GPL21272) was used for gene expression analysis according to the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: The complete RNA library was hybridised to SurePrint G3 Mouse GE 8×60K Microarrays (Agilent, Cat No. G4852A) using a partially modified version of manufacturer’s protocol as described in Version 6.9.1 of ‘One-Color Microarray-Based Gene Expression Analysis Protocol’ ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide microarrays for human whole genome (G4858A design 072363, 8×60k chips SurePrint G3 unrestricted GE, Agilent Technologies) were used for global gene expression analysis ...