Labshake search
Citations for Agilent :
51 - 100 of 592 citations for 8 Bromo 3 iodo quinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... Hybridization to SurePrint G3 Human Gene Expression 8×60K Microarrays (Agilent Technologies) was performed with the Gene Expression Hybridization Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA with a RINe value above 8 (as determined using Agilent TapeStation 2200) was fractionated on a 8% TBE-Urea gel to selected RNA molecules in the 17-26 nt range ...
-
bioRxiv - Cancer Biology 2022Quote: ... The plates were placed into a BioTek BioSpa 8 Automated Incubator (Agilent Technologies) and read by brightfield and fluorescence imaging on a BioTek Cytation 5 Cell Imaging Multi-Mode Reader (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA integrity (RIN >8) was verified on the Agilent 2200 TapeStation (Agilent Technologies), and 400 ng RNA was used for multiplex library preparation with the KAPA mRNA HyperPrep Kit (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: Microarray mRNA analysis was performed using Agilent 8 × 60 K oligonucleotide microarrays (Agilent Technologies Inc. ...
-
bioRxiv - Developmental Biology 2019Quote: ... were subjected to a SurePrint G3 Mouse GE v2 8×60K Microarray (Agilent). The microarray data obtained for this study are deposited in the Gene Expression Omnibus database (GEO ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 µl of each probe provided by Agilent was mixed with 8 µl IQFISH Fast Hybridization Buffer (#G9415A, Agilent Technologies, Inc).
-
bioRxiv - Neuroscience 2022Quote: ... and the integrity checked with a Bioanalyzer RNA pico chip (Agilent, RIN>8). cDNA libraries were prepared using a QuantSeq 3’ mRNA-Seq Library Prep kit FWD (Lexogen ...
-
bioRxiv - Immunology 2023Quote: Microarray analysis was performed using SurePrint G3 Mouse GE 8×60K slides (Agilent) and Partek Genomics Suite version 6.6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sections were then incubated with mouse anti-Ki67 (Dako, M724801-8, 1:200) or rabbit anti-Muc2 antibody (NBP1-31231 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and quality of total RNA was confirmed by BioAnalyzer 2100 (RIN > 8) (Agilent). cDNA was synthesized by SMART-Seq mRNA kit (Takara ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Biochemistry 2021Quote: ... 8×60K GSE ‘all 10-mer universal’ oligonucleotide arrays (AMADID #030236; Agilent Technologies, Inc.) were double-stranded and used in PBM experiments essentially as described previously ...
-
Chameleon microRNAs in breast cancer: their elusive role as regulatory factors in cancer progressionbioRxiv - Systems Biology 2020Quote: ... The samples were hybridized on Agilent 8×15K arrays (Agilent Technologies, Santa Clara, CA), catalogue number 4470B (v2 ...
-
bioRxiv - Genomics 2019Quote: ... and a well- established 8×60K fetal DNA chip (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Microbiology 2020Quote: A customized whole-genome DNA microarray of 630Δerm was used (8×15K format, Agilent) (50) ...
-
bioRxiv - Plant Biology 2019Quote: An 8×60K customized pea eArray (ID 045803, Agilent Technologies, Santa Clara, CA, USA) was used to scan the pea embryo transcriptome ...
-
bioRxiv - Developmental Biology 2021Quote: Transcriptomic profiling of the samples was performed with pikeperch-specific microarrays (8×60k, Agilent), which were designed and successfully validated previously (for details ...
-
bioRxiv - Developmental Biology 2021Quote: ... and hybridized with the custom microarrays (ID:085740, 8 x 60k arrays; Agilent Technologies) for 17h at 65°C ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Immunology 2022Quote: ... Assays were conducted using an XFp (8 well) system and analyzed using WAVE software (Agilent).
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... 800 rpm for 8 hours in a BioTek LogPhase 600 plate reader (Agilent Technologies, Inc.). Cell growth was monitored by measuring OD600 every 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 μg of total RNA with an RNA Integrity Number (RIN) ≥ 8 (Bioanalyzer 2100, Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: Agilent SurePrint G3 Mouse Gene Expression 8×60K Microarrays (Agilent Technologies, Santa Clara, CA, USA) were used for microarray experiments on purified CD4+CD25-CD62L-spleen lymphocytes ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). For ER ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). For CK5/6 ...
-
bioRxiv - Pathology 2023Quote: ... The slides were pre-treated by incubating 8 minutes with Peroxidase Blocking Reagent (S2001, DAKO). A monoclonal rabbit Ki67 antibody (M7240 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sections were immunostained using EnVision and ARK kits (DAKO, K400311-2 and K395411-8) according to manufacturer protocols ...
-
bioRxiv - Microbiology 2023Quote: ... RNA integrity number (RIN) was >8 for all samples (Agilent 1200 bioanalyzer, Alpha Metrix Biotech). Labeling of total RNA (100 ng ...