Labshake search
Citations for Agilent :
51 - 100 of 545 citations for 7 Oxa 12 thia 3 aza spiro 5.6 dodecane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Developmental Biology 2019Quote: ... service pack 3 (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Genomics 2021Quote: ... The quality of all 12 RNA samples was checked by Agilent RNA 6000 Nano Reagents Part1 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: TP53 Immunohistochemistry was performed with the mouse monoclonal antibody Do-7 (Dako, Glostrup, Denmark), according to standard protocols.
-
bioRxiv - Neuroscience 2021Quote: A 7 T horizontal small-bore magnet and (Agilent Technologies Inc, Santa Clara, USA) and a quadrature volume radiofrequency coil (39 mm internal diameter ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples with RIN values above 7 in the Bioanalyzer RNA 6000 Nano assay (Agilent) were used for the synthesis of complementary DNA and RT controls using a reverse transcription TATAA GrandScript cDNA Synthesis Kit (TATAA Biocenter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RIN (7-10) was calculated by capillary electrophoresis in a Bioanalizer (Agilent, Waldbronn, Germany). 2.5 µg (100 ng/µL ...
-
bioRxiv - Cancer Biology 2023Quote: ... RIN (7-10) was calculated by capillary electrophoresis in a Bioanalyzer (Agilent, Waldbronn, Germany).
-
PRC1 directs PRC2-H3K27me3 deposition to shield adult spermatogonial stem cells from differentiationbioRxiv - Developmental Biology 2023Quote: ... 7-µm-thick paraffin sections were deparaffinized and autoclaved in target retrieval solution (DAKO) for 10 min at 121°C ...
-
bioRxiv - Genomics 2024Quote: ... the integrity (RIN > 7) and concentration (ng/µl) were accessed using Bioanalyzer 2100 (Agilent). At last ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... (12) mouse anti-PCNA was used at 1:1000 (M0879; Dako Immunochemicals). This antibody was raised to a synthetic amino acid sequence (LVFEAPNQEK ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Molecular Biology 2021Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries were next hybridized in the following way ...
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries hybridisation was performed as described previously 68 using probes mapping to 122 polycomb target genes promoters and 78 control active gene promoters ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Pathology 2023Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... The quality of the cDNA was assessed on a Tape 12 Station (Agilent). A total of 1 ng purified cDNA was used as starting material for the library preparation ...
-
bioRxiv - Molecular Biology 2021Quote: ... MRI of lung was performed with a 7-T Agilent scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console and an actively shielded gradient set (205/120 insert of maximum 130 mT m-1 gradient strength) ...
-
bioRxiv - Cancer Biology 2020Quote: TP53 IHC was performed using monoclonal anti-TP53 antibody clone DO-7 (Dako, Carpinteria, CA, USA) using standard techniques described elsewhere57 on whole BM biopsy sections in a CLIA-certified laboratory ...
-
bioRxiv - Bioengineering 2022Quote: Dynamic release was performed using the 400-DS Apparatus 7 instrument (Agilent Technologies, Santa Clara, CA) at 37 °C in a 10 mL cell ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent, RIN score ≥ 7, 28S/18S ≥ 1). RNA concentration was measured using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA with RNA Integrity Number (RIN) > 7 when assessed using the Agilent 2100 Bioanalyzer (Agilent, USA) were selected to move forward for further sequencing.
-
bioRxiv - Physiology 2024Quote: MRI studies were performed using a 7-T Agilent/Varian scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescent images were obtained on a Keyence BZ-X710 microscope or on a Cytation 7 (Agilent).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We quantified sample RNA quantity and quality (RNA integrity number > 7) on a Tapestation 2200 (Agilent) at the University of Montana genomics core ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Neuroscience 2021Quote: ... and cover-slipped (Catalog #12-544-E) using fluorescence mounting medium (Dako, Cat. #S3023).
-
bioRxiv - Biochemistry 2019Quote: ... 12 μL of each reaction was injected on a HPLC (Agilent 1100, Agilent Technologies) and desalted by C4 column ...
-
bioRxiv - Biochemistry 2019Quote: ... 12 μL of each reaction was injected on a HPLC (Agilent 1100, Agilent Technologies) and desalted by C4 column ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 12 ‘GG’ at rs234453358) as measured on a TapeStation (Agilent, Santa Clara, CA, USA). The cDNA libraries were prepared with the NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina (NEW ENGLAND BioLabs ...
-
bioRxiv - Neuroscience 2023Quote: ... The fragment length of the libraries was verified using the Fragment Analyzer 12 (Agilent). Paired-end 150- base pair reads were sequenced with the NovaSeq 6000 platform (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... Site directed mutagenesis was performed according to manufacturer’s instructions (QuickChange II, Agilent, 200523-12). Following the PCR reaction ...
-
bioRxiv - Cancer Biology 2019Quote: MRI conducted at UT Southwestern was performed using a 7-Tesla small animal MRI system (Agilent Inc.) with a 40 mm (i.d. ...
-
bioRxiv - Cancer Biology 2019Quote: ... magnetic resonance data were acquired with a 7 T horizontal magnet Agilent ASR 310 (Agilent Technologies Inc.) equipped with nested 205/120/HDS gradient insert and a bore size of 310 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation as with the mitochondrial stress test astrocytes were transferred to XFmedia (Agilent) and glycolysis was assessed ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...