Labshake search
Citations for Agilent :
1 - 50 of 545 citations for 7 Oxa 12 thia 3 aza spiro 5.6 dodecane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: Patchoulol in dodecane was quantified via GC-MS (Agilent 7890A gas chromatograph interfaced with an Agilent 5975C inert MSD with Triple-Axis Detector) ...
-
bioRxiv - Bioengineering 2020Quote: Patchoulol in dodecane was quantified via GC-MS (Agilent 7890A gas chromatograph interfaced with an Agilent 5975C inert MSD with Triple-Axis Detector) ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were incubated with primary antibodies for cytokeratin 7 (CK7; OV-TL 12/30,DAKO,Ready-to-Use), 3-mercaptopyruvate sulfurtransferase (MPST ...
-
bioRxiv - Bioengineering 2022Quote: ... The dodecane samples were analyzed using an Agilent 7890A gas chromatograph (GC) equipped with a DB-5MS column (Agilent J&W, USA) attached to a 5975C mass spectrometer (MS ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: ... pHelper plasmid (240071-12, Agilent Technologies) and pAAV for in a 1:1:1 molar ratio using polyethylenimine (PEI ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cancer Biology 2019Quote: ... for p53 (clone DO-7, Dako, Carpinteria, California, USA) at 1:50 dilution and for Pax8 (clone MRQ-50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Evolutionary Biology 2019Quote: ... then assessed RNA quality using TapeStation (Agilent Technologies; RIN > 7). The Genome Sequencing and Analysis Facility at the University of Texas at Austin prepared TagSeq libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Neuroscience 2021Quote: ... Images were acquired on a 7 Tesla MRI scanner (Agilent Inc.) (23 ...
-
bioRxiv - Immunology 2023Quote: ... or R-phycoerythrin-cyanine-7 (PE-Cy7) fluorochromes (Prozyme, Thermo-Fisher).
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
The membrane-cytoplasmic linker defines activity of FtsH proteases in Pseudomonas aeruginosa clone CbioRxiv - Biochemistry 2023Quote: ... PaFtsH2H1-link-12 and site-directed mutagenesis (QuickChange, Agilent) was used to create PaFtsH2H1-link-10 ...
-
bioRxiv - Microbiology 2019Quote: ... Good quality RNA (RIN > 7, assessed by a Bioanalyzer 2100 (Agilent Technologies)) from total RNA and rRNA-subtracted RNA were converted to cDNA as described by (49 ...
-
bioRxiv - Immunology 2021Quote: A multi-channel 7 Tesla MRI scanner (Agilent Inc., Palo Alto, CA) was used to image brains in skulls ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were amplified 7× using Herculase II Fusion Polymerase kit (Agilent).
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation astrocytes were switched to XF media (Agilent) and then assessed using the previously described Mitochondrial Stress Test Protocol [24] ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Biochemistry 2021Quote: ... coli K-12 strains XL1-Blue (Agilent catalog number 200236) or NEB5α (NEB catalog number C2987H ...
-
bioRxiv - Microbiology 2023Quote: ... and the membrane was hybridized using QuickHyb (#201220-12 Agilent) to a 32P-labeled dsDNA NP ...
-
bioRxiv - Genetics 2023Quote: ... a pHelper (240071-12, Agilent Technologies, Santa Clara, CA, USA), and an ITR-flanked AAV plasmid (pAAVsc-JeT-MCOLN1-pA ...
-
bioRxiv - Molecular Biology 2021Quote: ... was generated from a 7-kb genomic clone from Lambda FIX Library (Stratagene) (Supplemental Fig ...
-
bioRxiv - Neuroscience 2019Quote: ... T2-weighted RARE images were acquired on a 7-T scanner (Varian/Agilent) with imaging parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality (RIN > 7) was confirmed using an RNA 6000 Nano Kit (Agilent). Spatial gene expression slides were processed following manufacturer instructions (Visium Spatial Gene Expression Reagent Kits User Guide ...
-
bioRxiv - Neuroscience 2022Quote: ... Postmortem data were then acquired on an 7 T small animal scanner (Agilent) fitted with a 40 G/cm gradient coil (Agilent ...
-
bioRxiv - Immunology 2023Quote: ... or cyan-7 conjugated R-phycoerythrin (PECy7) fluorochrome-conjugated streptavidin (Prozyme, Thermo-Fisher).