Labshake search
Citations for Agilent :
1 - 50 of 1729 citations for 7 Bromo 4 chlorothieno 3 2 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Immunology 2021Quote: ... For purines and pyrimidines metabolites ESI positive mode was used and analyzed using a 6495B triple quadrupole mass spectrometer (Agilent Technologies) coupled to a HPLC system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2A-D: Rabbit anti-GFAP (DAKO, Z033401-2); Fig ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Immunology 2024Quote: ... Cells (1-2 × 105) were plated in Poly-D-Lysine coated 96-well microplates (Agilent) with 4-5 technical replicates ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Immunology 2023Quote: ... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Immunology 2021Quote: ... 3×105 CD8+ T cells were plated onto poly-D-lysine coated wells and assayed in XF RPMI medium (Agilent) pH 7.4 supplemented with 10 mM glucose and 2 mM glutamine ...
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were transferred to a nitrocellulose membrane before probing using a primary anti IL-36γ antibody (Biotechne (R&D) UK) overnight at 4°C and a secondary goat antibody (Dako) for 1 hour at room temperature to visualise any protein cleavage.
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Neuroscience 2022Quote: ... washed in PBS (3 × 5min) and incubated with serum free protein block (Dako, Cat# X090930-2) for 1h at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Cancer Biology 2021Quote: ... before low pH antigen retrieval and staining with CD8a and Ki67 (Supplementary Table 7) antibodies and secondary antibody (EnVision+ HRP-rabbit, Dako, catalog #K400311-2) using the EnVision DuoFlex system (Dako) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis, ready-to-use, incubation 20 min, Agilent Technologies, Santa Clara, CA, USA). Antibody detection was performed using EnVision FLEX/HRP (GV80011-2 ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Developmental Biology 2019Quote: ... The following antibodies were incubated overnight at 4°C: rat anti-human CD31 (DAKO, M082329-2), rabbit anti-human S1PR1 (Santa Cruz ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Cancer Biology 2019Quote: ... Both the trap (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and the analytical (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2021Quote: ... D.03.00.611 (Agilent Technologies). Retention times were related to an injected Kovats linear alkane mixture of carbon chain length C8-C40 and linear retention indices for each peak were calculated (van Den Dool and Dec ...
-
bioRxiv - Cancer Biology 2019Quote: ... for p53 (clone DO-7, Dako, Carpinteria, California, USA) at 1:50 dilution and for Pax8 (clone MRQ-50 ...