Labshake search
Citations for Agilent :
251 - 300 of 1729 citations for 7 Bromo 4 chlorothieno 3 2 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...
-
Suppression of the Integrated Stress Response in Islet β Cells Decreases Risk of Autoimmune DiabetesbioRxiv - Cell Biology 2023Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Plant Biology 2019Quote: ... 1/4 pear sections from 4 fruits per replicate) were injected into a HP 5890A gas chromatograph (Agilent, Avondale, PA, USA) with a flame ionization detector (FID ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 4 hours at 4°C with rotation and processed using the Agilent Bravo liquid handling system (Agilent Technologies, Santa Clara, CA). Beads were washed twice with 0.1% NP-40 in Tris-buffered saline (50 mM Tris-HCl with 150mM NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μl of SureSelect probes (Agilent) were mixed with 2 μl of 25% RNAse block ...
-
bioRxiv - Immunology 2021Quote: ... HRP anti-Rabbit (Agilent, K400311-2) and EnVision+ Single Reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2020Quote: ... CD68 (Agilent, #GA60691-2, Clone KP1), Cleaved Caspase 3 (CST ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-PMEL (Agilent Technologies, #M063429-2), anti-ACTA2 (Sigma-Aldrich #C6198) ...
-
bioRxiv - Genetics 2019Quote: ... coli bacteria (Sure 2, Agilent Technologies) were transformed with pFPV25.1 (Valdivia and Falkow 1996 ...
-
bioRxiv - Physiology 2023Quote: ... and 50mM of 2-DG (Agilent) were injected during the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... clone D33 (Agilent Technologies M076029-2); western blot ...
-
bioRxiv - Pathology 2023Quote: ... stained with hematoxylin (S330130-2, Agilent) and stored at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10x AffinityScript buffer (Agilent), 2 μl 0.1 M DTT ...