Labshake search
Citations for Agilent :
151 - 200 of 1803 citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were amplified with 11 PCR cycles and the library size was analyzed by Agilent Tape Station (G2938-90014 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2019Quote: ... citrate pH 6 (Agilent Technologies). Slides were immersed with blocking solution (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... CK5/6 (IR 780, Dako), CK8 (35bH11 ...
-
bioRxiv - Immunology 2020Quote: ... RNA integrity number (RIN) exceeded 9 for all samples measured by 2100 Bioanalyser (Agilent). RNASeq libraries where prepared using Smartseq2 as described by Picelli et al (64) ...
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were rehydrated and cooked in DAKO Target Retrieval Solution pH 9 (#S236784, DAKO) for 20 min in microwave at ~600W ...
-
bioRxiv - Cancer Biology 2023Quote: ... and an RNA integrity number ≥ 9 was assessed by TapeStation RNA Screen Tape (Agilent). RNA-seq analysis was performed with the transcriptome for targeted next-generation sequencing by Macrogen (Tokyo ...
-
bioRxiv - Cell Biology 2023Quote: ... All samples had RIN scores greater than 9 (Agilent 4150 TapeStation System, G2992 AA) and underwent polyA-selection and stranded library preparation prior to sequencing at 150 paired end reads (Genewiz from Azenta Life Sciences) ...
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-C5b-9 antibody against the neoepitope (1:100, Agilent Dako) and incubated for 1h at RT ...
-
bioRxiv - Immunology 2023Quote: ... or a monoclonal anti-C5b-9 antibody against the neoepitope (1:100, Agilent Dako) and incubated for 1h at RT ...
-
bioRxiv - Immunology 2023Quote: ... Heat induced epitope retrieval (HIER) was conducted using target retrieval solution pH 9 (Dako S236784-2 ...
-
bioRxiv - Genomics 2020Quote: ... B (Cat # 720202, Agilent Inc, Santa Clara CA, USA). Vector recovery from genomic DNA ...
-
bioRxiv - Genetics 2020Quote: ... and b-OH-butyrate levels were determined by Agilent LC/MS 6410 Triple Quad system as described (Nissim et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Data processing: MassHunter software (v B.05.01, Agilent UK). Calibration curves were fitted using the simplest regression model to minimize back-calculated calibration standard concentration residuals over the range of study sample concentrations.
-
bioRxiv - Microbiology 2022Quote: ... The MassHunter Quantitative Analysis Software (Agilent, version B.09.00) was used for peak integration based on retention time (tolerance of 0.2 min ...
-
bioRxiv - Cell Biology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent). The peak areas of adenylates were calculated using following parameters (m/z ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CA125 epitope group B (Agilent, M11, 1:100), or anti-CA125 epitope group B (Fitzgerald ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Genomics 2023Quote: ... on the DS-11 FX instrument (Denovix) and evaluation of DNA integrity on FEMTO Pulse (Agilent), 12 μg of DNA was prepared for sequencing using Megaruptor 3 shearing (Diagenode ...
-
bioRxiv - Neuroscience 2020Quote: RNA samples (50-100 ng) with RIN scores from 7.6 to 9 (Agilent 4200 TapeStation) were reverse transcribed to cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were treated with an antigen retrieval solution (Target Retrieval pH 9, #S2367, DAKO) for 20 min ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... an OD 260/280 ratio greater than 1.9 and a RIN > 9 (Agilent Bioanalyzer 2100) were chosen for cDNA library construction ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using a Bravo Automated Liquid Handling Platform Option B (Agilent). All libraries were sequenced in the same way ...
-
bioRxiv - Plant Biology 2020Quote: For data deconvolution the software Profinder B.08.02 (Agilent Technologies) was used ...
-
bioRxiv - Biochemistry 2020Quote: ... we used Masshunter Qualitative Analysis version B.07 (Agilent Technologies) and the Molecular Feature Extraction tool to extract H+ ...
-
bioRxiv - Biophysics 2019Quote: ... Data was analysed using MassHunter Qualitative Analysis B.06.00 (Agilent). Compound purity was calculated using the highest value of %UV (at 254 nm ...
-
bioRxiv - Molecular Biology 2019Quote: ... MassHunter B.06.01 software (Agilent Technologies, Santa Clara, CA, USA) was used for all data acquisition and MZmine 2 was used for data processing (Pluskal et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... Data were acquired using Profinder B.08.00 SP3 software (Agilent). Intracellular relative abundance of metabolites was normalized to cell number for GC/MS samples or by total ion current (TIC ...
-
bioRxiv - Immunology 2021Quote: ... MassHunter B.06.01 software (Agilent Technologies, Santa Clara, CA, USA) was used for all data acquisition ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... MassHunter B.06.01 software (Agilent Technologies, Santa Clara, CA, USA) was used for all data acquisition and MZmine 2 was used for data processing.
-
bioRxiv - Biochemistry 2022Quote: ... M/z spectra were analysed using Masshunter B.07.00 (Agilent); ESIprot (49 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The data was analyzed using MassHunter (Agilent version B.07.00). The retention times (RT ...
-
Macrodomain Mac1 of SARS-CoV-2 Nonstructural Protein 3 Hydrolyzes Diverse ADP-ribosylated SubstratesbioRxiv - Biochemistry 2023Quote: ... MassHunter Qualitative Analysis Version B.07 (Agilent Technologies, CA, USA). Spectral matching of obtained MS/MS spectra was performed with spectral libraries Human Metabolome Database (HMDB ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies). Levels of AMP ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies). Levels of AMP ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies).
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 μm i.d ...
-
bioRxiv - Cell Biology 2023Quote: ... The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 μm i.d ...