Labshake search
Citations for Agilent :
1 - 50 of 1803 citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Immunology 2021Quote: ... After incubation with HRP-secondary antibody (30min) and Aminoethyl Carbazole (AEC) + High Sensitivity Substrate Chromogen (Dako) (for IHC ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Immunology 2024Quote: ... Antigen retrieval was performed using Antigen Retrieval Solution (pH 6 or pH 9) (Dako, Glostrup, Denmark) for at least 15 minutes in an autoclave ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Microbiology 2021Quote: ... A bright red chromogen labelling was produced with 3-amino-9-ethylcarbazole substrate (AEC, DAKO). Sections were counterstained with Mayer’s haematoxylin ...
-
bioRxiv - Biochemistry 2019Quote: ... OCR and ECAR were measured 3 times every 9 minutes using a XFe96 Analyzer (Seahorse Bioscience) at a baseline and after addition of each drug ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pH 9 (Dako) and endogenous peroxidase activity was blocked using 3% hydrogen peroxide ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9 (Dako Agilent) at 97°C from 10 min and cooled down to 65°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (Dako, S2367) in a microwave for 25 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent S2367). The chamber was heated to 125 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9 (Dako Agilent) at 97°C from 10 min and cooled down to 65°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... pH 9 (both Dako), endogenous peroxidase activity was blocked using 3% hydrogen peroxide and sections were blocked in PBS with 10% FBS (blocking buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (Agilent, #S2375) were heated to 97 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... pH 9 (Agilent, S2367) for 15 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... pH 9 (Agilent, S2367). 400µl/slide of primary antibody was incubated on slides overnight at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 9 (Dako, S2367) at 115°C for 15 minutes in a pressure cooker for antigen retrieval ...
-
bioRxiv - Cancer Biology 2024Quote: ... pH 9 (Dako, S2367) with a pressure cooker for 20 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Tissues next underwent antigen retrieval by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97 °C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Pathology 2021Quote: ... Tissues next underwent antigen retrieval by submerging slides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Pathology 2020Quote: ... Deparaffinization and antigen retrieval were performed in Target Retrieval Solution with pH 9 (ACE2) or pH 6 (Ki-67) at 97°C for 20 min using the PT Link platform (Dako, Glostrup, Denmark). Subsequently ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on the antibody used (HIF-1α, Dako Target Retrieval Solution pH 6; for BACH-1, Dako Target Retrieval Solution pH 9). Next ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 solution (Dako, S2367) in a pressure cooker at 125°C for 15 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Neuroscience 2022Quote: ... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2020Quote: ... were separated by a gradient elution from 5% solvent B to 95% solvent B over 15 min on a high-capacity nano-LC chip (Agilent Technologies; part no. G4240-62010) driven by a 1200 series nano-flow HPLC system (Agilent ...
-
bioRxiv - Microbiology 2019Quote: ... followed by 5 minutes of re-equilibration at 0% B (Agilent 1290 Infinity LC system). Post-column ...