Labshake search
Citations for Agilent :
251 - 300 of 4848 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... or 1 μM (OMM2.3) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 μM of a rotenone antimycin A mix (Agilent). Following the assay ...
-
bioRxiv - Cancer Biology 2019Quote: ... Slides were incubated at 4°C overnight and then washed and visualized with DAB+ substrate chromogen (Agilent Technologies). The patient groups with 249T-P positive and negative were divided at 10% cutoff value.
-
bioRxiv - Developmental Biology 2021Quote: ... then at 4°C overnight with primary antibodies diluted in Dako REAL Antibody Diluent (Agilent, Santa Clara, CA). We used the following primary antibodies ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were seeded at 4×104 cells per well in Seahorse XF24 tissue culture plates (Seahorse Bioscience Europe). The sensor cartridge was placed into the calibration buffer medium supplied by Seahorse Biosciences to hydrate overnight ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... The m6A level was then determined using a Synergy 4 automatic microplate reader (Agilent BioTek; Winooski, VT, USA) at 450 nm.
-
bioRxiv - Genomics 2023Quote: ... which brought the total number of DNA probes to 174,550 spots for a 4×180k microarray (Agilent Technologies). Additional spots on the array were set aside for control grid alignment ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with an eliminated kanamycin-resistance cassette (Supplementary Fig. 4) and XL10-Gold (Agilent Technology, Inc., Santa Clara, CA), were used for cloning and library construction ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were seeded at 4 x 104 cells per well in XFe24 cell culture microplates (Agilent, 102340-100) in 10 ml of DMEM [high glucose DMEM with pyruvate (Gibco ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse methyl capture sequencing (Methyl-Seq) libraries were generated using the SureSelectXT Methyl-Seq Target Enrichment System (Agilent, Santa Clara, CA, USA, #G9651B) and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent ...
-
bioRxiv - Cancer Biology 2022Quote: ... explants treated with BrdU substrate for 24 hours prior to fixation as described in Section 6.3.1) (DAKO, Cat. M0744; 1:50 overnight at 4 °C), cytokeratin (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...
-
bioRxiv - Cell Biology 2020Quote: ... the membrane was incubated with horseradish peroxidase-conjugated streptavidin (P0397; Dako; 1:3000, 3% BSA) at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein lysates were incubated at 4°C with a mouse monoclonal antibody directed against the FLAG-tag (M2, Stratagene). Immunocomplexes were pulled down by incubation with protein G sepharose ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the cells were washed twice with 200 μL/well of assay medium (XF DMEM Base Medium, pH 7.4 containing 25 mM Glucose and 4 mM Glutamine; Agilent). After washing ...
-
bioRxiv - Plant Biology 2021Quote: ... A total of 4 µL of each filtered sample was loaded onto a C18 high-capacity nanoLCchip (Agilent Technologies) using a 1200 series capillary pump (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gene expression analysis was conducted using Agilent Whole Mouse Genome 4×44 multiplex format oligo arrays (Agilent Technologies 014868) following the Agilent 1-color microarray-based gene expression analysis protocol ...
-
bioRxiv - Pathology 2022Quote: ... DNA microarray analysis was performed using a Quick Amp labeling kit and a Whole Human Genome DNA Microarray 4×44K according to the manufacturer’s protocol (Agilent). Signal intensity was normalized by adjusting the data to a 75th percentile value ...
-
bioRxiv - Neuroscience 2021Quote: iNeurons were replated on DIV 4 onto polyornithine/laminin coated in the Seahorse XF96 Cell Culture Microplate (Agilent Technologies) at a density of 50 000/well ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The spinal cord tissue was dissected and packed into a 4 mm zirconium rotor (Agilent Techonology Inc., CA, USA) with 50 μL of D2O saline (0.9% ...
-
bioRxiv - Microbiology 2021Quote: ... and Tyr 254 in TlpALBD were generated via site-directed mutagenesis of pBH4_TlpALBD with primers listed in Supplemental Table 4 (QuikChange, Stratagene). TlpALBD and all point mutants were purified as described by Sweeney et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and C21 was accomplished using a C18 Security guard cartridge (4.6 × 4 mm) and Zorbax Extend-C18 column (4.6 × 75 mm, 3.5 μm, Agilent 766953-902) at 40 °C (mobile phase A = H2O + 0.1% formic acid ...
-
bioRxiv - Genetics 2024Quote: ... Cryosections were incubated overnight at 4°C with primary antibodies: polyclonal anti-GFAP (Dako, Agilent, Santa Clara, California, USA) (1:5000 in 1% BSA ...
-
bioRxiv - Genetics 2024Quote: ... Cryosections were incubated overnight at 4°C with primary antibodies: polyclonal anti-GFAP (Dako, Agilent, Santa Clara, California, USA) (1:5000 in 1% BSA ...
-
bioRxiv - Physiology 2024Quote: ... Sections were fixed with 0.2% glutaraldehyde + 4% PFA and mounted with Glycergel Mounting Medium (Agilent Technologies, Santa Clara, CA). The antisense probe generated with T7 polymerase showed the specific signal ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated overnight at 4°C with primary antibodies in DAKO REALTM Anti-body diluent (Agilent, Cat#S2022). Secondary antibodies (1:500 dilution ...
-
bioRxiv - Microbiology 2024Quote: ... samples were cleared for 7 min at 14,000 × g at 4 °C and transferred to LC-MS polypropylene conical vials (Agilent). Vials were stored at −80 °C until analysis using LC-MS.
-
bioRxiv - Cell Biology 2024Quote: ... 4 technical replicates for each time point were analysed using Microwave Plasma - Atomic Emission Spectrometry (MP-AES 4210, Agilent) as reported previously24.
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...