Labshake search
Citations for Agilent :
51 - 100 of 4848 citations for 6H Pyrazolo 3 4 b pyridin 6 one 3 cyclobutyl 1 2 4 5 tetrahydro 4 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... were induced with 2μg/mL doxycycline for 6 hours prior to crosslinking at 100mJ/cm2 at 4°C in a Stratalinker 1800 (Stratagene). Cells were then processed according to the eCLIP protocol for input and immunoprecipitated samples until cDNA was obtained ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 4 hours at 4°C with rotation and processed using the Agilent Bravo liquid handling system (Agilent Technologies, Santa Clara, CA). Beads were washed twice with 0.1% NP-40 in Tris-buffered saline (50 mM Tris-HCl with 150mM NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 6 minutes (30 seconds ON, 30 seconds OFF) at 4°C to obtain ~200 bp fragments (confirmed using an Agilent Bioanalyzer). Sonicated DNA was extracted using ethanol precipitation ...
-
bioRxiv - Pathology 2019Quote: The clinical data and level 3 mRNA microarray data (Agilent 244K TCGA Custom 1-2) of primary GBM samples were downloaded from the NCI Genomic Data Commons ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Cancer Biology 2022Quote: 2×104 – 4×104 cells per well were plated onto a Seahorse XFe96 FluxPak plate (Agilent, 102416-100). On the day of the assay ...
-
bioRxiv - Bioengineering 2021Quote: ... and incubated overnight at 4 °C with primary antibodies: Anti-GFAP 1:1000 (Z0334, Dako), Anti-CD68 1:400 (MCA1957 ...
-
bioRxiv - Immunology 2019Quote: ... 4°C overnight followed by HRP conjugated goat-anti-rabbit IgG (#P0448, Dako (1:1000). α-Tubulin was used as a housekeeping control (#sc-32293 ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Biochemistry 2022Quote: ... with 4 cycles per step using Seahorse XFe96 Analyzer (Agilent). Cell Mito Stress Test was used for assessing mitochondrial function ...
-
bioRxiv - Biophysics 2019Quote: ... A 4 mm triple-resonance HXY MAS NMR probe (Agilent) was used under static condition ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... Free-floating sections were incubated overnight (4 °C) with rabbit anti-GFAP (1:500; DAKO, Z0334). The antibody was prepared in 10% donkey serum in PBS containing 0.02% sodium azide and 0.3% triton X-100 ...
-
bioRxiv - Immunology 2024Quote: ... at 4 °C ON and afterward incubated with rabbit anti-HA antibody 1:2000 (Dako, A0001) 2 h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µm tissue sections were stained and developed using AutostainerPlus (Dako). Antibodies were diluted in block solution and sections were incubated for 30 minutes with primary antibody and 20 minutes with secondary antibodies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Cancer Biology 2019Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step DNA was purified by Ampure XP beads (Beckmann Coulter Genomics #A63882) ...
-
bioRxiv - Cancer Biology 2019Quote: Whole Human Genome Microarray Kit 4×44K (Agilent, Cat. No. G4112F) was used to detect mRNA expression levels in cells transfected with control and miR-101-3p transfected HCT116 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Each SBC mouse (4*180K) LncRNA microarray slide (Agilent Technologies Inc.) was hybridized with 1.65 μg Cy3-labeled cRNA using a gene expression hybridization kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... and then overnight at 4°C in rabbit anti-CD3 (Dako) in 1% (v/v ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Canis (V2) Gene Expression Microarray 4×44K (Agilent Technologies). Microarray data were subjected to gene ontology (GO ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Microbiology 2021Quote: Headspace CO concentrations were monitored every 2-4 days using an Agilent 6890N gas chromatograph (GC; Agilent Technologies, California, US) equipped with a nickel catalyst methaniser (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with the primary (Supplementary Table 2) (overnight 4°C) and the secondary (HRP-conjugated anti-mouse or -rabbit, DAKO) (2h ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... the plasma was diluted 4:1 with Buffer A for Multiple Affinity Removal LC Columns (Agilent Technologies) and filtered through a 0.22 μm hydrophilic PVDF membrane filter plate (Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... They were then incubated overnight at +4 °C with the 6F3D anti-Aβ antibody (Dako, 1/200), polyclonal anti-tau antibody (Dako ...
-
bioRxiv - Developmental Biology 2019Quote: ... was applied at 4°C overnight and secondary polyclonal goat anti-mouse-HRP (Agilent P0447; 1:1,000) was applied for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C with anti-total tau primary antibody solution (1: 5000, DAKO A0024). After 1 hour incubation at RT in the corresponding secondary antibody solution (donkey anti-rabbit 800) ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...