Labshake search
Citations for Agilent :
151 - 200 of 4214 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm particle size (Zorbax XDB C8, Agilent Technologies). The analytes were eluted using a gradient starting with 50% mobile phase B that increased to 98% within 2.3 min and was held for 1.0 min ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse phase-S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Neuroscience 2021Quote: ... diluted 1:300 in TNB (E043201-8, Agilent Dako) for 45 min ...
-
bioRxiv - Neuroscience 2021Quote: ... diluted 1:300 in TNB (E043201-8, Agilent Dako) for 45 min ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Molecular Biology 2019Quote: ... After quality check (Agilent Bioanalyzer Agilent Technologies, Wilmington, DE) samples were used to generate RNA-seq libraries using the Illumina Truseq RNA Sample Prep protocol (Illumina ...
-
bioRxiv - Systems Biology 2021Quote: ... and fragment sizes were determined by Agilent bioanalyzer High Sensitivity DNA LabChip (Agilent Technologies, Wilmington, DE) followed by dilution to 10 nM ...
-
bioRxiv - Systems Biology 2021Quote: ... and fragment sizes were determined by Agilent bioanalyzer High Sensitivity DNA LabChip (Agilent Technologies, Wilmington, DE). Amplicons were spiked with a PhiX control library to 20% and mixtures were then sequenced on an Illumina MiSeq V2 (250nt from each end) ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Neuroscience 2021Quote: ... 5–20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The rate of injection was ∼20 nl/minute ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The rate of injection was ~20 nl/min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5–20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The speed of injection was ∼0.1 μl/10 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was passed up and down through a 29-gauge needle 6-8 times and the fragment size distribution was determined (∼30 kbp; TapeStation, Agilent).
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Genetics 2019Quote: ... de-salted using Strataclean resin according to instruction (Agilent Technologies) and electroporated in 2 ul aliquots into DH10B-MegaX cells (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... validated using an Agilent 2100 Bioanalyzer (Agilent, Wilmington, DE, USA), and quantified with a Qubit 2.0 Fluorometer (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Agilent XFe96 Seahorse analyzer (Agilent Technologies, Wilmington, DE). HCT116 cells (0.75 x 104 ...
-
bioRxiv - Immunology 2022Quote: ... the membrane was incubated in secondary antibody solutions (TBS containing 0.1 % Tween-20 and 5 % BSA, HRP-conjugated secondary antibodies (1:5000, Dako)) at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... in 20 min at a flow rate of 0.4 mL min-1 using a Zorbax Narrow Bore (2.1×50 mm, 5 μm) C18 column (Agilent Technologies).
-
bioRxiv - Biochemistry 2022Quote: ... Sample from each PNT3 variant at 5 mg mL-1 in buffer B containing 6M GDN was injected onto an AdvanceBio SEC 2.7 µm (Agilent) SEC column ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated with 1 × blocking buffer (5% goat serum [#X0907, Dako], 2.5% BSA, 0.1% Triton X-100 in PBS) (38) ...
-
bioRxiv - Biophysics 2020Quote: ... After rinsing for 5 minutes in PBS they were incubated with secondary antibody (Rabbit Anti-Mouse 1/200, Dako) for 30 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were blocked in 0.2% triton X-100 solution containing 1% BSA and 5% normal goat serum (DAKO, X0907) for 1 hour.
-
bioRxiv - Physiology 2024Quote: ... live cells stained with Hoechst 33342 (1:2,000 dilution) (ThermoScientific, Cat#62249) were enumerated using Cytation 5 plate reader (BioTek Instruments - Agilent). Values obtained from the Mito-Stress test were normalized per 1,000 cells.
-
bioRxiv - Physiology 2024Quote: ... Rehydrated 5-μm sections were stained with primary antibodies against insulin (dilution 1:1000; Dako, Santa Clara, CA, USA), somatostatin (dilution 1:300 ...
-
bioRxiv - Physiology 2021Quote: HUVECs (passages 4-6) were seeded in XFe 24 well plates (Agilent, Santa Clara, CA, USA) at 30,000 cells per well in 200 µL EGM for 48 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-μm sections were obtained and stained with hematoxylin (Dako) and eosin (VWR ...
-
bioRxiv - Neuroscience 2019Quote: ... and QuikChangeII XL Site-Directed Mutagenesis (Agilent Technologies Cat# 200521-5) kits ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples with RIN values > 5 as assessed by TapeStation (Agilent Technologies) were prepared with KAPA mRNA HyperPrep kit (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were obtained using a Biotek Cytation 5 Multimode Reader (Agilent) to generate (at minimum ...
-
bioRxiv - Plant Biology 2019Quote: ... GC-separation was achieved on a HP-5 column (Agilent Technologies) using the following temperature gradient ...
-
bioRxiv - Immunology 2020Quote: ... FBXO10 E54K was generated by site-directed mutagenesis (Stratagene 200521-5) using the following primers:
-
bioRxiv - Cell Biology 2022Quote: ... both solvents containing 5 µM Infinity Lab deactivator additive (Agilent Technologies). The elution gradient used was as follows ...