Labshake search
Citations for Agilent :
1 - 50 of 4214 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or with minor N-terminal truncations to exclude the transmembrane regions (Sphaeroforma arctica: amino acids 21-316; Auxenochlorella protothecoides: amino acids 21-327) in Arctic Express DE competent cells (Agilent). At the N-terminus ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 µm (Agilent). Next ...
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... Paraffin embedded human brain sections were de-waxed for antigen retrieval with 90% formic acid (5 min) followed by citrate boiling (45min, 98°C DAKO Citrate Buffer, DAKO PT Link). Sections were then blocked using 0.1% (w/v ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cell Biology 2024Quote: ... 5[μm column (Agilent).The mobile phases were MS solvent A (H2O ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were washed for 5 minutes using 1X Wash Buffer and then blocked by adding 8 drops of Protein Block Serum-Free (Agilent). Primary antibodies were diluted in diluent (Dako ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Microbiology 2019Quote: ... The obtained BALF was concentrated using 5 kDa cutoff 4 ml spin concentrator (Agilent Technologies, USA) before infectivity experiments.
-
bioRxiv - Molecular Biology 2020Quote: ... (Agilent Technologies, Wilmington, DE) equipped with an autosampler ...
-
bioRxiv - Cell Biology 2021Quote: ... (Agilent Technologies, Wilmington, DE) equipped with an autosampler ...
-
bioRxiv - Molecular Biology 2020Quote: ... (Agilent Technologies, Wilmington, DE) equipped with an autosampler ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Neuroscience 2019Quote: ... After one last wash with DPBS for 5 minutes at RT the coverslips were imbedded in fluorescent mounting medium (DAKO #S3023). Primary antibodies that were used ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of eluted RNA and 5 µL RNA ScreenTape sample buffer was mixed in an 8-well PCR tube strip (Agilent Technologies) via vortexing for one minute (IKA MS3 Vortexer ...
-
bioRxiv - Neuroscience 2021Quote: ... Next day membranes were washed for 3 x 5 min and incubated with HRP-coupled secondary antibodies (DAKO) diluted 1:3000 in washing buffer for 1.5 hour at RT ...
-
bioRxiv - Genetics 2023Quote: ... slides were carefully rinsed 3 × 5 min with PBS and slides were mounted with Fluorescent Mounting Medium (Dako) and examined under fluorescence using a Zeiss microscope equipped with an AxioCam HRm camera.
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were washed twice with PBS + 0.5% Triton X-100 and then rinsed one time with PBS before mounting with DAKO Fluorescence Mounting Medium (S3023; Dako NA Inc.). Images were analyzed with a Nikon Eclipse Ti fluorescence microscope with a Plan Fluor 40 Å∼ /1.30 Oil DIC N2 objective ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl C18 Cartridges (Agilent) were used as solid phase ...
-
bioRxiv - Microbiology 2021Quote: ... A bright red chromogen labelling was produced with 3-amino-9-ethylcarbazole substrate (AEC, DAKO). Sections were counterstained with Mayer’s haematoxylin ...
-
bioRxiv - Biochemistry 2021Quote: ... coli BL21 DES cells (Agilent). Cells were grown in Luria Broth in the presence of the selective antibiotic at 37 °C to an OD600 of ∼0.8 ...