Labshake search
Citations for Agilent :
151 - 200 of 802 citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-μm sections were obtained and stained with hematoxylin (Dako) and eosin (VWR ...
-
bioRxiv - Neuroscience 2019Quote: ... and QuikChangeII XL Site-Directed Mutagenesis (Agilent Technologies Cat# 200521-5) kits ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples with RIN values > 5 as assessed by TapeStation (Agilent Technologies) were prepared with KAPA mRNA HyperPrep kit (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Data were collected on a Cytation 5 plate reader (Agilent Technologies) using a green fluorescent polarization filter (excitation and emission wavelengths of 485 nm and 528 nm ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were obtained using a Biotek Cytation 5 Multimode Reader (Agilent) to generate (at minimum ...
-
bioRxiv - Plant Biology 2019Quote: ... GC-separation was achieved on a HP-5 column (Agilent Technologies) using the following temperature gradient ...
-
bioRxiv - Immunology 2020Quote: ... FBXO10 E54K was generated by site-directed mutagenesis (Stratagene 200521-5) using the following primers:
-
bioRxiv - Cell Biology 2022Quote: ... both solvents containing 5 µM Infinity Lab deactivator additive (Agilent Technologies). The elution gradient used was as follows ...
-
bioRxiv - Bioengineering 2022Quote: ... with a 5-Å column (Agilent, 25m x 0.25mm x 30μm). Hydrogen that evolved during the BPEC stabilization stage (see previous section ...
-
bioRxiv - Neuroscience 2022Quote: ... Images were acquired on a Biotek Cytation 5 Multimode Reader (Agilent) with the same gains and exposure across all animals for each stain ...
-
bioRxiv - Systems Biology 2022Quote: ... and desalted via 5 μg C18 columns on an AssayMap (Agilent) following the standard protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... chamber slides were scanned with an automated microscope (Cytation 5, Agilent) with a 4x objective and filters for high-contrast brightfield and GFP fluorescence ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sialidase A (5 mU, Prozyme/Agilent, Santa Clara, CA, USA) overnight at 37°C in order to deglycosylate peptides (Larsen et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a carbohydrate column (4.6 × 150 mm, 5 μm, Agilent Technologies). The sugar concentrations were quantified according to a standard solution (Sigma ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... held for 5 min and connected to the GC-MS (Agilent 7890B GC and 5977 MS ...
-
bioRxiv - Microbiology 2023Quote: ... We exported bacterial growth data from the software (Gen 5, Agilent Technologies ...
-
bioRxiv - Immunology 2023Quote: ... using the Cytation 5 Cell Imaging Reader (Agilent BioTek, CA, USA). Lactate levels present in the samples were estimated from the standard curve.
-
bioRxiv - Bioengineering 2024Quote: ... Cell invasion depth was measured using Gen 5 software (Agilent Technologies), and endothelial microvessel formation was quantified by measuring the average microvessel length at each time point with Fiji (NIH ...
-
bioRxiv - Molecular Biology 2020Quote: ... were induced with 2μg/mL doxycycline for 6 hours prior to crosslinking at 100mJ/cm2 at 4°C in a Stratalinker 1800 (Stratagene). Cells were then processed according to the eCLIP protocol for input and immunoprecipitated samples until cDNA was obtained ...
-
bioRxiv - Cell Biology 2021Quote: ... The C18 StageTips were constructed in-house using 6 layers 3M Empore solid phase extraction C18 (Octadecyl) membrane (Agilent Technologies) inserted into a 200 μL LoBind micropipette tip ...
-
bioRxiv - Immunology 2022Quote: ... and exonic splicing elements (ΔESE2 and ΔESS3) in IL7R exon 6 were introduced using the QuikChange Lightning Site-Directed Mutagenesis kit (Agilent) following the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then washed twice with DPBS and mounted using DAKO fluorescent mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI; Agilent). For visualisation of endogenous TDP-43 and FUS ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Pathology 2022Quote: Exonic sequences were enriched in the DNA sample of patient II-6 using SureSelect Human All Exon 50 Mb Kit (Agilent Technologies ...
-
bioRxiv - Genetics 2020Quote: ... genomic DNA from various tissues (Supplemental Table 6) was purified and used for library construction with target enrichment using the SureSelectQXT Target Enrichment kit (Agilent). Custom RNA capture probes were designed to hybridize with the 120 bp 5’ ends of the 5’LTRs and the 120 bp 3’ ends of the 3’LTR of about 600 intact (internal region flanked by two LTRs ...
-
bioRxiv - Microbiology 2020Quote: ... Small RNAs (6–150 nucleotides) and microRNA fractions (10–40 nucleotides) were quantified using high-resolution small RNA analysis (Agilent 2100 Bioanalyzer system ...
-
bioRxiv - Cell Biology 2020Quote: ... The equivalent of 6 ng of resulting cDNA was used as a template for real time PCR using a Mx3000P thermocycler (Agilent) with a home-made SYBR Green qPCR master mix (Lutfalla & Uze ...
-
bioRxiv - Neuroscience 2020Quote: Total lysate and synaptoneurosomes isolated from cortex tissue of 1-month-old C57Bl/6 mice were UV crosslinked (100 mJ/cm2 for 2 cycles) using UV Stratalinker 2400 (Stratagene) and stored at −80°C until use ...
-
bioRxiv - Cancer Biology 2022Quote: ... For cross validation samples (n=6) the All-In-One solid tumor panel (AIO, Agilent, Santa Clara, USA, catalog # G9706S) was used for capture ...
-
bioRxiv - Microbiology 2022Quote: We extracted extracellular metabolites from the seawater matrix using Bond Elut PPL cartridges (1 g/6 ml sized cartridges, Agilent) following the protocol of Dittmar et al ...
-
bioRxiv - Neuroscience 2023Quote: ... Mitochondrial bioenergetics were assessed at 6 weeks of differentiation using the Mitochondrial Stress Test measured on a Seahorse XFe96 Analyzer (both Agilent). Stress tests were carried out according to manufacturer’s instructions and cycling parameters ...
-
bioRxiv - Immunology 2023Quote: For CFTR detection in cross sections, target retrieval was performed with a citrate buffer (Target Retrieval solution, pH 6, (Dako) for 30min after deparaffinization ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA-resistant versions of Cofilin-1 have been obtained by mutating 6 bp of the siRNA-targeting sequence using QuickChange (Agilent). Plasmids were transiently transfected in HeLa cells for 48 hours using X-tremeGENE 9 DNA reagent (Roche) ...
-
bioRxiv - Cell Biology 2024Quote: Cell proliferation rates were measured with label-free high-contrast brightfield microscopy in 6-well plates using Cytation 1 Cell Imaging Multi-Mode Reader (BioTek Instruments, Agilent) as described previously 58 ...
-
bioRxiv - Physiology 2024Quote: ... MLO-Y4 cells with Pparγ silenced with siRNA (γY4KD) and their scrambled control (Scrl) were plated 6 hrs before the assay onto Seahorse cell culture microplates (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Different FMv2-MDM4 versions containing mutations or deletions of single or combined L22 consensus sequences in MDM4 intron 6 were generated by QuikChange site-directed mutagenesis (200516, Agilent).
-
bioRxiv - Microbiology 2023Quote: ... The sample was passed up and down through a 29-gauge needle 6-8 times and the fragment size distribution was determined (∼30 kbp; TapeStation, Agilent).
-
bioRxiv - Immunology 2023Quote: ... antigen retrieval using sodium citrate buffer (10 mM, pH 6) was performed for 15 min at 110 °C in a DAKO Pascal pressure chamber (Agilent). After blocking in PBS supplemented with 10% goat serum (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were loaded on a Superose 6 Increase column (Cytiva) run by a 1260 Infinity II HPLC (Agilent Technologies) at 0.6 mL/min ...
-
bioRxiv - Neuroscience 2021Quote: ... For ChR2-mediated optogenetic stimulation, blue light (473 nm, 6 Hz or 20 Hz) was produced using an arbitrary waveform generator (Agilent, 33220A) and a diode-pumped solid-state laser (Laserglow ...
-
bioRxiv - Developmental Biology 2019Quote: ... The quality of the purified DNA library was assessed on 6%TBE gels as well as on a Bioanalyzer (2100 Expert software, Agilent Technologies) using High Sensitivity DNA Chips (5067-4626 ...
-
bioRxiv - Developmental Biology 2020Quote: ... RIN scores (RIN = 10 for all 6 samples) were measured on a BioAnalyzer 2100 using the RNA 6000 Nano assay (Agilent Technologies). Poly(A)-purified mRNA-seq library preparation was performed according to the TruSeq Stranded mRNA Reference Guide (Illumina) ...
-
bioRxiv - Synthetic Biology 2021Quote: Thermal denaturation experiments were performed using a qCHANGER 6/Cary60 (Quantum Northwest) interfaced to a Cary 60 UV-Visible spectrophotometer (Agilent Technologies) using a custom ADL script developed by Quantum Northwest to collect full spectra at each temperature as described previously ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 6 minutes (30 seconds ON, 30 seconds OFF) at 4°C to obtain ~200 bp fragments (confirmed using an Agilent Bioanalyzer). Sonicated DNA was extracted using ethanol precipitation ...
-
bioRxiv - Molecular Biology 2023Quote: The complex formation between CtBP1 and CtBP2 variants and RAI2 variants was investigated on an analytical Superose 6 3.2/300 GL column (Cytiva, MA, USA) coupled to a 1260 Infinity HPLC system (Agilent, CA, USA). Proteins were dialyzed against the SEC buffer and injected onto a pre-equilibrated S6 column using an autosampler ...