Labshake search
Citations for Agilent :
101 - 150 of 802 citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Cultures were blocked for 45 min with blocking buffer (BB) containing 6%Goat serum (Dako, S-100) in DPBS ...
-
bioRxiv - Neuroscience 2019Quote: ... PSD-95 in tissues from the L4-6 spinal cord segments were amplified by PCR (Stratagene M3005p), and a pair of GAPDH primers and Taqman probe were added into each reaction system as the internal reference of PCR amplification ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: guinea pig anti-Insulin (1:6, Dako, IR00261-2), mouse anti-Glucagon (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... then impedance was measured every 15 min for 6 h using an xCELLigence RTCA DP instrument (Agilent). Due to the nature of the assay ...
-
bioRxiv - Immunology 2023Quote: The following primary antibodies were used after performing antigen retrieval with Target Retrieval solution (pH 6) (Dako): rabbit anti-DCLK1 (Abcam ...
-
bioRxiv - Bioengineering 2024Quote: ... serotype 6 (AAV6) vector plasmid derived from the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA). Experiments were performed with rAAV6 vectors produced and purified by SignaGen Laboratories (Frederick ...
-
bioRxiv - Molecular Biology 2019Quote: ... onto a peptide trap (Zorbax 300 SB-C18, 0.3 i.d. × 5 mm, 5 µm, 300 Å; Agilent Technologies, Santa Clara, CA, USA) for concentration and desalting with a pump running in isocratic mode with 0.1% formic acid in water ...
-
bioRxiv - Cell Biology 2020Quote: ... permeabilized and blocked in 5% goat serum (DAKO, X0907), 0.3% Triton-X-100 (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Immunology 2019Quote: A C18 (Agilent ZORBAX 300SB, 5 μm, 300 Å) pre-column (360 μm o.d ...
-
bioRxiv - Synthetic Biology 2021Quote: ... with a Bio SEC-5 2000 Å guard (Agilent). The mobile phase was PBS ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
bioRxiv - Systems Biology 2022Quote: ... equipped with a VF-5 ms column (Agilent Technologies) of 30 m length ...
-
bioRxiv - Immunology 2023Quote: Images were acquired with a Biotek Cytation 5 (Agilent) and images were analyzed with Biotek Gen5 software ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 μl SYBR green (Agilent Technologies, CA, United States), and 2 μl nuclease-free water ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5’ and mounted with fluorescent mounting medium (Dako). The Lmx1a antibody detection capability was improved using the Tyramide Signal Amplification kit (TSA ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μm particle size (Zorbax XDB C8, Agilent Technologies). The analytes were eluted using a gradient starting with 50% mobile phase B that increased to 98% within 2.3 min and was held for 1.0 min ...
-
bioRxiv - Cell Biology 2024Quote: ... QuikChange II Site-Directed Mutagenesis Kit (Agilent, 200523-5) was used for mutagensis of GFP-VPS35L constructs following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Reverse phase-S cartridges (Agilent, 5 μL bed volume) were primed with 250 μL 99.9% acetonitrile (ACN ...
-
bioRxiv - Bioengineering 2019Quote: ... The electrical state was tested with a resistance meter (34401A 6 ½ Digit Multimeter, Agilent, Santa Clara, CA, USA) between different tapping points (connector – solder pads on interconnecting ceramic – wires anterior to interconnecting ceramic) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... (Mildford, MA, USA) and vacuum manifold system (VacElut 6 Manifold Processing Station, Agilent Technologies, Santa Clara, CA, USA) were used for solid-phase extraction (SPE).
-
bioRxiv - Microbiology 2020Quote: ... The plasmid for production of (His)6-SUMO-σAntA-DD was generated by site-directed mutagenesis (Agilent QuikChange) using primers listed in Table S3 ...
-
bioRxiv - Biochemistry 2022Quote: ... MNase-digested samples were loaded on 6% PAGE and stained with SybrGOLD and run on a Bioanalyzer (Agilent) using DNA High sensitivity chips ...
-
bioRxiv - Molecular Biology 2023Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA-resistant versions have been obtained by mutating 6 bp of the siRNA-targeting sequence using Quickchange (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were steamed for 35 minutes with a pH 6 Dako Target Retrieval (Agilent Technologies, S169984-2) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was heated to 40°C for an isocratic 6-minute run paired with a 5977B GC/MSD (Agilent).
-
bioRxiv - Genetics 2024Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Plant Biology 2020Quote: ... from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6). For expression analysis in control conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin embedded TMA slides were processed for antigen retrieval for 15 minutes performed using TAR buffer pH 6 (Dako) in a steamer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Embedded tissue sections were pre-treated with a heat induced epitope retrieval (HIER) method (pH 6, DAKO, Hamburg, Germany). As secondary antibody anti-rabbit Polymer-AP (Enzo Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Bioengineering 2022Quote: ... Freshly prepared sample (6 μL) was injected on an ZORBAX SB-Aq column (Agilent, 4.6 × 100 mm, 3.5 μm). The column temperature was set to 45 °C ...
-
bioRxiv - Immunology 2021Quote: ... 10μM ADP or 1μM TRAP-6 in the presence of fluorescein isothiocyanate–conjugated polyclonal rabbit anti-fibrinogen antibody (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplified cDNA sequences were modified and cloned into BamHI and XhoI sites of pCMV-3FLAG-6 vector (Agilent, 240200). To produce shRNA lentivirus particles ...