Labshake search
Citations for Agilent :
201 - 250 of 776 citations for 6 METHYL 3 OXO HEPTANOIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Genetics 2019Quote: ... slides were incubated in antigen retrieval solution (Target Retrieval Solution Citrate pH 6; Dako cytomation) at 98°C for 20 minutes and then cooled at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... or hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cell Biology 2022Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent).
-
bioRxiv - Cell Biology 2019Quote: A fluorescein-conjugated peptide nucleic acid (PNA) telomere detection kit for flow cytometry (Cat.#K5327, Dako) was used following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Amino acids were then converted into respective fluorescent derivatives using o-phthalaldehyde (OPA) (Agilent #5061-3335). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... acidified with formic acid and subsequently desalted using AssayMap C18 cartridges (Agilent, Santa Clara, CA, USA) mounted on an Agilent AssayMap BRAVO liquid handling system ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The concentrations of glucose and organic acids were detected by a HPLC (Agilent 1260, Waldbronn, Germany) equipped with a refractive index detector (RID) ...
-
bioRxiv - Immunology 2021Quote: ... Quality and integrity of nucleic acids were assessed using the Agilent Technologies 2100 Bioanalyzer (Agilent Technologies) after each step ...
-
bioRxiv - Physiology 2023Quote: ... amino acids and nicotinamide adenine dinucleotide reduced (NADH) and oxidized (NAD+) forms) was created from Agilent METLIN PCDL for identification within the samples ...
-
bioRxiv - Synthetic Biology 2023Quote: The residual glucose and organic acids were analyzed using high performance liquid chromatography (HPLC, Agilent, USA) equipped with a refractive index detector (RID ...
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were microwaved in pH 6 antigen retrieval solution (1X Target Retrieval Solution, Agilent Cat # S1699) to bring near to ...
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Physiology 2021Quote: HUVECs (passages 4-6) were seeded in XFe 24 well plates (Agilent, Santa Clara, CA, USA) at 30,000 cells per well in 200 µL EGM for 48 h ...
-
bioRxiv - Immunology 2023Quote: ... Heat-induced epitope retrieval was performed for 15 min in Target Retrieval solution (pH 6) (Dako) and all other steps were as described above for mouse snout processing ...
-
bioRxiv - Immunology 2024Quote: ... Antigen retrieval was performed using Antigen Retrieval Solution (pH 6 or pH 9) (Dako, Glostrup, Denmark) for at least 15 minutes in an autoclave ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mutations in amino acid position 339 of KLF1 were introduced by site directed mutagenesis (Agilent Technologies), primers are available upon request ...
-
bioRxiv - Biochemistry 2019Quote: ... using a linear gradient from 5 to 55% acetonitrile over 6.5 min with 0.1% formic acid as the aqueous mobile phase after an initial hold at 95% 0.1% formic acid for 0.5 min (0.6 mL/min) using a 1290 Infinity II UHPLC (G7120AR, Agilent). Peptides were identified using LC-HRMS as described previously.23
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Biochemistry 2019Quote: ... 0.1% [v/v] formic acid in water and injected onto an Agilent1200 (Agilent, Santa Clara, CA, USA) nano-flow LC system that was in-line coupled to the nano-electrospray source of a LTQ-Orbitrap Discovery hybrid mass spectrometer (Thermo Scientific ...
-
bioRxiv - Zoology 2021Quote: ... The amino acid composition of the hydrolyzed samples was determined using High Performance liquid Chromatography (HPLC-Agilent 1260 Infinity series ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...