Labshake search
Citations for Agilent :
101 - 150 of 776 citations for 6 METHYL 3 OXO HEPTANOIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: Gas chromatography was performed on an HP-5MS capillary column (5% benzene/95% methyl polysiloxane 30 m × 250 μm i.d., 0.25 μm film thickness, Agilent J & W Scientific, Folsom, CA, USA) with a constant flow of helium at 1 mL/min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and fixed with precooled methyl alcohol in −20℃ for 30 min followed by H&E staining (Eosin, Dako CS701, Hematoxylin Dako S3309, bluing buffer CS702), sections were processed at RT by isopropanol (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Neuroscience 2022Quote: ... HEK-293T cells were co-transfected with the following plasmids: pAAV/L7-6-Slc9A6-GFP or pAAV/L7-6-GFP (control) with pHelper (Stratagene, La Jolla, CA, USA), and pUCmini-iCAP-PHP.eB followed by viral particles purification ...
-
bioRxiv - Bioengineering 2020Quote: ... The concentration of the ester in the n-hexadecane phase was quantified using a gas chromatography-mass spectrometry (GC-MS, Agilent Technologies 6890N, Santa Clara, CA) equipped with an HP-5 column (60m×0.25 mm ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guinea Pig anti-Insulin pre-diluted 1:6 (Dako 1R002), Chicken anti-GFP 1:1000 (Abcam ab13970) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... low pH∼6 (Dako, K8005; Agilent, Santa Clara, CA, USA), with preheating to 80°C and increased temperature to 95°C for 20min after slides were added ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... low pH∼6 (Dako, K8005; Agilent, Santa Clara, CA, USA), with preheating to 80°C and increased temperature to 95°C for 20min after slides were added ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... for amino acids and an Eclipse Plus C18 (1.8 μm; Agilent) for TCA and PPP intermediates ...
-
bioRxiv - Microbiology 2021Quote: ... The fatty acid profiles were analyzed by gas chromatography (Agilent 7890A) using the RTSBA6 method/library ...
-
bioRxiv - Genetics 2021Quote: ... and organic acids by a dual-wavelength absorbance detector (Agilent G1314F).
-
bioRxiv - Physiology 2021Quote: Amino acid concentrations were determined with high-performance liquid chromatography (Agilent Technologies 1100 HPLC System ...
-
bioRxiv - Neuroscience 2022Quote: ... Anti glial fibrillary acid protein (Abcam, GFAP, Dako Z0334 1:1000); Anti CD68 (Biorad MCA1957 ...
-
bioRxiv - Neuroscience 2022Quote: ... and glial fibrillary acid protein (GFAP; Z0334, Dako, RRID:AB_10013382, 1:500) were performed as previously described (Muñoz-Manchado et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Silica beads functionalized with phenyl-boronic acid (Bondesil-PBA 40µm, Agilent) were used for glycopeptides enrichment at an optimized ratio of 1:2.5 sample:PBA beads w/w ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-Krt5/6 (1:200; M7237; Agilent; Santa Clara, CA), and mouse anti-Krt14 (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen was retrieved using DakoCytomation target retrieval solution pH 6 (Dako). Samples were then blocked with serum-free protein block solution (Dako ...
-
bioRxiv - Plant Biology 2020Quote: The contents of celastrol and wilforic acid A were analyzed by Agilent 1260LC-6400 QQQ (triple quadrupole mass) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The Long-Chain Fatty Acid Substrate Oxidation kit (Agilent cat #103672-100) was utilized to probe differences in OCR upon injection with either vehicle (media only ...
-
bioRxiv - Cancer Biology 2022Quote: ... The matrix employed was α-cyanohydroxycinnamic acid obtained in solution from Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... Resin acid identification and quantification were performed by capillary GC (Agilent 7890A). Helium ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100 ...
-
bioRxiv - Biophysics 2022Quote: ... Amino acid analysis was performed on an Agilent 1260 HPLC (Agilent Technologies) equipped with a fluorescence detector using automated o-phtalaldehyde/2-mercaptopropionic acid (OPA/MPA ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Bioengineering 2019Quote: ... Stage 6 clusters were loaded into islet capture microplates (Agilent; 101122-100) in RPMI with 2 mM glucose ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Biochemistry 2023Quote: ... Antigen retrieval was performed with Citrate Buffer (pH 6) (Dako, Glostrup, Denmark). Immunohistochemical staining was performed with anti VEGFA or anti-S100A8 (Table I) ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...