Labshake search
Citations for Agilent :
151 - 200 of 2761 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Peptides were first loaded onto a C18 trap column (5 µm, 5 × 0.3 mm, Agilent Technologies) and then eluted into a C18 analytical column (75 μm × 150 mm ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Neuroscience 2023Quote: ... Plates were consecutively incubated with: rabbit anti-total tau antibody (K9JA, Dako #A0024, 5 μg/ml), anti-rabbit secondary antibody conjugated with biotin (Invitrogen #A16114 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were blocked with 5 μg/ml human immunoglobulins solved in blocking serum-free medium (Dako) for 30 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μm particle size (Agilent Technologies) was employed for metabolite separation with a linear gradient of 95:5 A/B to 30:70 A/B over 5 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% mouse serum (Agilent, Germany). Positive cells were isolated with the micromanipulator and subjected to whole genome amplification.
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 5% donkey serum (Dako) in PBS and incubated with primary antibody (α-TFAM (Mouse ...
-
bioRxiv - Bioengineering 2023Quote: ... BioTek Cytation 5 Cell Imager (Agilent) was used to take RFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2% BSA (PAA Laboratories GmbH, Germany) and 1:50 dilution of normal goat serum (Dako Denmark A/S, Denmark). Subsequently ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2023Quote: ... using a C8 reverse phase micro-column (Zorbax 300SB-C8, 5 µm, 5 × 0.3 mm, Agilent Technologies). The sample was then eluted with 70% of mobile phase B (flow rate of 50 µl/ min ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Microbiology 2019Quote: ... Sample separation was done with a CP-PoraBOND Q column (50 m × 0.32 mm ID, 5 um film thickness; Agilent Technology, Netherlands) operated isothermally at 40°C using helium as a carrier gas at a flow rate of 2.0 ml/min ...
-
bioRxiv - Molecular Biology 2019Quote: ... Tryptic peptides were re-dissolved in 10 μl 5% formic acid and 6 μl was injected onto a 50 mm 300 μm C18 trap column (Agilent Technologies) followed by an initial wash step with Buffer A (5% (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were washed a further 3 times in TBS-T for 5 minutes and developed with DAB diluted at a 1:50 ratio in DAB-chromagen (Agilent; #K3468) until appearance of brown staining ...
-
bioRxiv - Neuroscience 2024Quote: ... 6.5-9) and concentration (5-50 ng/µl; 260/280 values >1.7) were evaluated using the Agilent 2100 Bioanalyzer (Agilent Technologies, CA) and Nanodrop (Thermo-fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions, Santa Clara, CA), fibronectin (2 μg/ml clone MAB1918 ...
-
bioRxiv - Molecular Biology 2023Quote: ... goat anti-rabbit IgG (250 ng ml−1, 1% BSA in PBST; Agilent, P044801-2) or rabbit anti-goat IgG (500 ng ml−1 ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Microbiology 2022Quote: ... αIgG (Agilent Cat#A042402-2). Cells were cultured in RPMI-1640 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Krt8/18 (DAKO M365201-2), GATA6 (R&D AF1700 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent, Cat# Z033429-2) Stained sections with only secondary antibodies were used as controls ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Physiology 2019Quote: ... ACC1/2 (DAKO DENMARK, P0397), phospho-ACC Ser212 (Millipore,03303).HDAC4 (7628 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) by induction with 1 mM IPTG in 2X YT medium at 20°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... DAB chromogen (Agilent, K346889-2) with hematoxylin counter stain (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...