Labshake search
Citations for Agilent :
401 - 450 of 2761 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... anti-mouse IgG HRP-linked (P044701-2, Dako), and anti-rabbit IgG HRP-linked (P044801-2 ...
-
bioRxiv - Immunology 2022Quote: ... Dako fluorescent mounting medium (#S302380-2, Agilent, USA) was used to mount cover slips which were sealed with nail polish ...
-
bioRxiv - Immunology 2022Quote: ... and mouse anti-human CD68 (Dako, M087601-2) and rabbit anti-human PD-L1 (Ventana ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM Pyruvate and 2 mM Glutamine (Agilent; 103015-100 ...
-
bioRxiv - Immunology 2022Quote: ... and 2 mM L-glutamine (103579-100; Agilent) for 1 h at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 2 mM glutamine (Agilent Technologies, 1003579-100). 5 x 105 cells per well were plated in XF24 Seahorse Biosciences plates pre-coated with Cell-Tak (Corning ...
-
bioRxiv - Cancer Biology 2022Quote: ... IHC for human Ki67 (IR62661-2, Agilent Technologies) was used to ensure the propagated tumors were comprised of human cells ...
-
bioRxiv - Neuroscience 2021Quote: ... The primary antibody against GFAP (Dako, Z033429-2) was used at 1:500 dilution and Alexa Fluor405 secondary antibody at 1:500 dilution ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM L-glutamine (103579-100, Agilent Technologies) and 1 mM sodium pyruvate (103578-100 ...
-
bioRxiv - Microbiology 2020Quote: ... coli v.2 (Agilent product number G4813A-020097) and gDNA extraction is described in detail in (Submitted dataset to DiB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-GFAP (1:5,000, Dako, Z033401-2). The next day ...
-
bioRxiv - Cancer Biology 2021Quote: ... and counterstained with Hematoxylin (Agilent DAKO, K800821-2) for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... and counterstained with Hematoxylin (Agilent DAKO, K800821-2) for 5 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 mM glutamine (#103579-100, Agilent Technologies) before analysis ...
-
bioRxiv - Immunology 2021Quote: ... Slides were incubated with DAB (Agilent, GV82511-2), washed twice for three minutes with TBST ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 9 (S236784-2, DAKO, Carpinteria, CA, USA), for 20 min in a microwave oven ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, 1:1000, Agilent). All commercial antibodies are validated by vendors ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... Coverslips were mounted using Glycergel (DAKO, C056330-2) preheated to 60°C ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-CD31 (1:200 dilution, M082329-2, Dako), Goat anti-Rabbit IgG Cross-Adsorbed Secondary Antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Gfap (1:1000, Agilent #Z033401-2); rabbit anti-alpha-Sma (1:200 ...
-
bioRxiv - Genomics 2022Quote: ... the Dako Bluing Buffer (Agilent Technologies, CS70230-2) was removed from each well and then each well washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Genomics 2022Quote: ... 75µL of Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was added to each tissue section well ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2 mM glutamine (Agilent, Santa Clara, CA). The plate was incubated in a 37°C non-CO2 incubator for 1h prior to measurement ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2% proteinase K (Dako Omnis) in Tris-HCl buffer solution (pH 7.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM glutamine solution (cat 103579-100) (Agilent). Neuron cultures were transferred to a non-CO2 incubator for 1 hour prior to running the assay ...
-
bioRxiv - Neuroscience 2024Quote: ... or anti-GFAP (#Z03340-2, Agilent, 1:500). Visualizations of the primary antibodies were achieved using suitable secondary antibodies conjugated with Alexa fluorophores (Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2024Quote: ... or anti-GFAP (#Z03340-2, Agilent, 1:500). Subsequently ...
-
bioRxiv - Cell Biology 2024Quote: ... Retrieval Solution High pH (Agilent Cat#GV80411-2), 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cell Biology 2024Quote: ... Retrieval Solution Low pH (Agilent Cat#GV80511-2), Retrieval Solution High pH (Agilent Cat#GV80411-2) ...
-
bioRxiv - Cell Biology 2024Quote: ... Dako REAL Peroxidase-blocking reagent (Agilent S202386-2), bluing reagent (Leica ...
-
bioRxiv - Cancer Biology 2023Quote: ... antibody proteinase K (Agilent Tech Cat# S302080-2) digestion was done ...
-
bioRxiv - Neuroscience 2023Quote: ... and GFAP rabbit (1:500, DAKO, Z033429-2) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... The Vimentin primary antibody (Agilent, Cat#M072529-2) was diluted 1:75 in 2.5% horse serum ...
-
bioRxiv - Genomics 2023Quote: ... and GFAP (1:1000, Rabbit, DAKO, Z033401-2). Following primary antibody incubation sections were washed 4x2 minutes with TBST and stained with species-appropriate secondary antibody conjugated to a Horseradish Peroxidase (HRP ...
-
bioRxiv - Neuroscience 2024Quote: ... For GFAP (1:1000, Agilent Technologies, Z033429-2), Iba1 (1:500 ...
-
bioRxiv - Immunology 2024Quote: ... diluted in Antibody diluent solution (Dako, S080983-2) overnight at 4ºC ...
-
bioRxiv - Immunology 2024Quote: ... or goat anti-rabbit IgG (Agilent, P044801-2), secondary antibodies diluted 1/1000 in 5% (w/v ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 mM L-glutamine (103579-100, Agilent Technologies) and 1 mM sodium pyruvate (103578-100 ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Microbiology 2024Quote: ... Colorimetric conversion was terminated by addition of 5% SDS (50 uL per well) and absorbance was measured at 414 nm using a BioTek Epoch 2 Microplate Spectrophotometer (Agilent Technologies, Santa Clara, CA, USA). The endpoint absorbance of each sample was determined on a plate-by-plate basis where the absorbances of all the blank wells were averaged and multiplied by three ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).